Evidence-based Complementary and Alternative Medicine : eCAM. Dec/31/2017; 2018

Published online Mar/20/2018

PMID: 29743924

PMC: 5884281

doi: 10.1155/2018/5738101

Emodin Alleviates Liver Fibrosis of Mice by Reducing Infiltration of Gr1^hi Monocytes

Guiyang Wang+7 authors

Abstract

Emodin, as a major active component of Rheum palmatum L. and Polygonum cuspidatum, has been reported to have antifibrotic effect. However, the mechanism of emodin on antifibrotic effect for liver fibrosis was still obscure. In the present study, we aimed to investigate whether emodin can alleviate carbon tetrachloride- (CCl₄-) induced liver fibrosis through reducing infiltration of Gr1^hi monocytes. Liver fibrosis was induced by intraperitoneal CCl₄ injection in mice. Mice in the emodin group received emodin treatment by gavage. Pretreatment with emodin significantly protected mice from liver inflammation and fibrosis revealed by the decreased elevation of serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST), as well as reduced hepatic necrosis and fibrosis by analysis of hematoxylin-eosin (HE) staining, Masson staining, α-smooth muscle actin (α-SMA), and collagen-I immunohistochemistry staining. Further, compared to CCl₄ group, mice in the emodin group showed significantly less intrahepatic infiltration of Gr1^hi monocytes. Moreover, emodin significantly inhibited hepatic expression of interleukin-1β (IL-1β), tumor necrosis factor-α (TNF-α), transforming growth factor-β1 (TGF-β1), granulin (GRN), monocyte chemoattractant protein 1 (MCP-1), and chemokine ligand 7 (CCL7), which was in line with the decreased numbers of intrahepatic Gr1^hi monocytes. In conclusion, emodin can alleviate the degree of liver fibrosis by reducing infiltration of Gr1^hi monocytes. These results suggest that emodin is a promising candidate to prevent and treat liver fibrosis.

1. Introduction

Liver fibrosis, characterized by excessive deposition of extracellular matrix (ECM), is a pathological change after chronic liver injury including viral infection, toxic damage, metabolic disorders, and alcohol abuse [1]. However, there is still a lack of effective drugs for the treatment of liver fibrosis [2]. Understanding the mechanisms of liver fibrosis is important for prevention and control of liver disease progression.

Different cell types in the liver make a network and regulate liver fibrogenesis [3]. During the past decades, it became apparent that hepatic macrophages play central functions in initiating, perpetuating, and restricting liver fibrosis [1, 4–6]. Hepatic macrophages participate in liver fibrosis through various ways. Importantly, hepatic macrophages mediate the transdifferentiation of hepatic stellate cells (HSCs) into collagen-producing myofibroblasts by secreting several profibrotic factors, such as transforming growth factor-β1 (TGF-β1), platelet-derived growth factor (PDGF), and granulin (GRN) in liver fibrosis [1, 5, 7–9]. Besides, hepatic macrophages can release many proinflammatory cytokines such as tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β), and IL-6 which may induce liver cellular apoptosis and aggravate liver inflammation [8, 10, 11]. Thus, hepatic macrophages are an attractive target for novel therapeutic approaches to liver fibrosis [12].

Hepatic macrophages comprise resident Kupffer cells (KFs) and infiltrating monocyte-derived cells [13]. During the development of liver fibrosis, macrophage pool of the liver can be rapidly expanded by infiltrating phagocytes that mainly originate from circulating monocytes [14–16]. In mice, two major populations of circulating monocytes exist: Gr1^hi (Ly-6C^hi) monocytes and Gr1^lo (Ly-6C^lo) monocytes. In acute and chronic liver injury of mice, Gr1^hi monocytes are massively recruited into the liver [8, 11]. As vigorous secretors of proinflammatory and profibrotic factors including TNF-α and TGF-β1, they drive inflammation and activate HSC thereby triggering a cascade of events leading to liver fibrosis [10, 17].

The accumulation of monocytes is critically due to chemokines monocyte chemoattractant protein 1 (MCP-1) and chemokine ligand 7 (CCL7) [8, 18–20]. When the liver is damaged, liver cells, HSCs, macrophages, and endothelial cells can secrete MCP-1 and CCL7 which combine with the related receptor-chemokine receptor on peripheral blood monocytes surface and recruit Gr1^hi monocytes into liver [8, 21, 22].

In the past two thousand years, Rheum palmatum L. and Polygonum cuspidatum has been used as Traditional Chinese Medicine to treat liver diseases, which has achieved significant curative effects [23]. As the main active ingredient of Rheum palmatum L. and Polygonum cuspidatum, emodin has been demonstrated to have anti-inflammatory, antitumor, and antifibrotic effects [24, 25]. Further study suggested that emodin has certain antifibrotic effect on liver fibrosis [26, 27]. However, the mechanism of emodin on the antifibrotic effect for liver fibrosis is still obscure. Therefore, in the present study we investigated whether emodin could alleviate the degree of carbon tetrachloride- (CCl₄-) induced liver fibrosis by inhibiting infiltration of Gr1^hi monocytes.

2. Materials and Methods

2.1. Mice

Male C57BL/6 mice, 7-8 weeks old, weighing 25 ± 2 g, purchased from Beijing Vital River Experimental Animals Technology (Beijing, China), were used in this study. Mice were housed under laminar airflow hoods in a specific pathogen-free room with a 12 h light and 12 h dark schedule and fed autoclaved chow and water at a controlled temperature of 22 ± 2°C, 50–60% relative humidity.

2.2. Experimental Protocol

Mice were randomly assigned to the control group, CCl₄ group, and emodin group. For induction of liver fibrosis, mice in the emodin group and CCl₄ group were injected intraperitoneally with 0.6 ml/kg dose of CCl₄ (CCl₄ : olive oil = 1 : 4, 3 μl/g CCl₄ oil) twice weekly for 4 weeks. Mice in the control group were injected with equal volume of olive oil as control. Emodin was dissolved in 0.25% sodium carboxymethyl cellulose (CMC-Na) aqueous solution to prepare the appropriate concentration. Emodin was given by gavage at a dose of 20 mg/kg/d in the emodin group. This dose of emodin is the optimal dose proved by the previous study [27]. For the control group and CCl₄ group, mice were administrated orally with the same volume of CMC-Na aqueous solution.

After 48 h of the last CCl₄ administration, mice were sacrificed after anesthesia. Blood samples were collected for ALT and AST detection. The liver tissues of mice were collected.

2.3. Liver Function Detection

Blood samples were centrifuged at 4000 rpm/min for 15 min to get serum. ALT and AST levels were determined with clinical testing technique through biochemical instrument (Beckman Coulter, Inc., Brea, CA, USA).

2.4. Flow Cytometry

Isolation of liver-infiltrating lymphocytes was performed by an automated, mechanical disaggregation system (Medimachine, Becton Dickinson, USA). The liver samples of mice were washed with PBS twice and then cut into small pieces of 3-4 mm³. Five pieces were immediately put in a disposable disaggregator Medicon with 50 μm separator mesh (Becton Dickinson, USA) and then 1 ml PBS was added and processed in the Medimachine System for 1 min. Disaggregated cells were removed and pressed through 70 μm cell strainers to obtain single cell suspensions. Cells were used immediately for flow cytometric analysis. Related antibodies were listed as follows: CD45 (557235, BD Pharmingen, USA), CD11b (557397, BD Pharmingen, USA), Gr1/Ly6C (560595, BD Pharmingen, USA), Ly6G (551460, BD Pharmingen, USA), and F4/80 (25-4801, eBioscience, USA). Flow cytometric analysis was performed on a FACS Aria II (BD Bioscience, USA).

2.5. Histopathology

Mouse liver tissues were fixed in paraformaldehyde for 48 h, then dehydrated, and finally embedded with paraffin. Paraffin-embedded liver samples were sectioned to 3 μm thin slices, which were performed with hematoxylin-eosin (HE) staining and Masson staining according to standard protocols.

2.6. Immunohistochemistry

3 μm paraffin sections of mouse liver samples were dewaxed and hyalinized. Endogenous peroxidase was blocked with 3% H₂O₂. Antigen repair was achieved by boiling in ethylenediaminetetraacetic acid- (EDTA-) alkaline solution. Then, sample sections were incubated with various primary antibody: α-smooth muscle actin (α-SMA, ab5694, Abcam, USA), collagen-I (ab34710, Abcam, USA), F4/80 (ab111101, Abcam, USA), CD45 (ab10558, Abcam, USA), CD11b (ab13357, Abcam, USA), TGF-β1 (ab92486, Abcam, USA), GRN (ab191211, Abcam, USA), MCP-1 (ab25124, Abcam, USA), or CCL7 (orb315556, Biorbyt, UK) overnight at 4°C. Then the sections were stained with secondary antibody (Life Technologies, USA) after multiple flushing with PBS buffer. At last, generally diaminobenzidine (DAB) stained, haematoxylin slightly stained, and neutral balata fixed.

2.7. Histological and Immunohistochemical Evaluation

Sections with HE staining were examined under light microscopy by an experienced pathologist in a blinded fashion for liver steatosis, necrosis, and leukocyte infiltration.

For Masson staining and immunohistochemical staining of α-SMA and collagen-I, five ×100 magnification images of Masson staining and immunohistochemical staining were captured in each section. Positive staining area of Masson staining (blue), α-SMA, or collagen-I immunohistochemical staining (brown) per high-power field (HPF) of each image was converted into pixels by Image-ProPlus software (Media Cybernetics, USA). The percentage of positive area was expressed as a fraction of the total number of pixels, averaged across the 5 different regions per section.

Absolute counts of CD45⁺ cells (leucocytes), F4/80⁺ cells (macrophages), and CD11b⁺ cells (monocytes) per HPF of stained liver sections were manually assessed in 5 different fields per section. All quantification was carried out blinded and without prior knowledge of sections or groups.

2.8. Real-Time Gene Expression Analysis

Total RNA was extracted from 50 mg frozen liver tissues using TRIzol according to the manufacturer's instructions (Life Technologies, USA) and then reverse-transcribed to get cDNA by using the PrimeScript RT Master Mix kit (Takara, China) according to the relevant experimental manual. Real-time PCR was performed on Step One Plus Real-Time PCR Systems (Life Technologies, USA) using SYBR Premix Ex Taq kit (Takara, China). All primers and PCR product sizes of this study are listed in Table 1. β-Actin was used as an internal control [28].

2.9. Statistical Analysis

All data are expressed as the mean ± standard error of the mean (SEM). Statistical analysis was performed using one-way analysis of variance (ANOVA) test by SPSS 22.0 software. P < 0.05 was considered to be statistically significant.

3. Results

3.1. Emodin Attenuated CCl₄-Caused Liver Inflammation

The protective effect of emodin on CCl₄-induced liver injury was identified by liver function and HE staining. As shown in Figure 1(a), the serum ALT and AST increased significantly in mice of CCl₄ group as compared with the control group. Emodin can significantly reduce the increased liver enzymes. The liver tissues of mice in the CCl₄ group showed liver steatosis, necrosis, and leukocyte infiltration which were significantly relieved in the emodin group (Figure 1(b)). These results demonstrated that emodin can significantly reduce CCl₄-induced liver inflammation in vivo.

3.2. Emodin Alleviated Liver Fibrosis Induced by CCl₄

Masson staining was used to observe the collagen fibers of liver tissues. As shown in Figure 2, fiber staining only appeared on the central venous wall, part of portal area, and interlobular septa in hepatic lobules of control mice. However, compared to the control group, the collagen fibers in CCl₄ group were significantly higher. The initial formation of interlobular septa and significantly increased portal fiber deposition were observed. The liver tissues of mice in the emodin group also had fiber deposition, mainly distributed at the portal area, fibrous septum, and central vein. But the density of collagen deposition was significantly less than that of CCl₄ group. Moreover, the liver tissues of mice in the control group had only a small amount of α-SMA and collagen-I expression (Figure 2). However, the hepatic expression of α-SMA and collagen-I significantly increased in the CCl₄ group (Figure 2). Emodin treatment can significantly reduce the expression of α-SMA and collagen-I induced by CCl₄ (Figure 2). These results collectively demonstrated that emodin can significantly reduce CCl₄-induced liver fibrosis in vivo.

3.3. Emodin Reduced Gr1^hi Monocyte Infiltration

After CCl₄ challenge for 4 weeks, infiltrations of leukocytes, monocytes, and macrophages increased significantly in the mouse liver tissues of CCl₄ group. However, compared to CCl₄ group, mouse liver tissues of emodin group had greatly reduced infiltrations of leukocytes, monocytes, and macrophages (Figures 3(a) and 3(b)). The proportion of Gr1^hi monocyte (CD45⁺Ly6G⁻CD11b⁺F4/80⁺Gr1^hi) subset increased significantly in the liver tissues of CCl₄ group as compared with the control group. However, the proportion of Gr1^hi monocyte subset was significantly lower in the emodin group compared to the CCl₄ group (Figure 4(b)). These results suggested that emodin can significantly reduce infiltration of monocyte-derived macrophages, especially Gr1^hi monocyte in chronic liver injury.

3.4. Emodin Inhibited the Expression of Gr1^hi Monocyte Associated Proinflammatory and Profibrogenic Cytokines

Gr1^hi monocyte can promote liver fibrosis through releasing many proinflammatory and profibrotic cytokines [1, 5, 7–9]. As shown in Figures 5 and 6, the intrahepatic mRNA expression of IL-1β, IL-6, TNF-α, TGF-β1, and GRN significantly increased after CCl₄ administration. Mice in the emodin group had significantly lower intrahepatic expression of IL-1β, TNF-α, GRN, and TGF-β1 as compared with CCl₄ group. As shown in immunohistochemical staining, emodin group had significantly lower expression of TGF-β1 and GRN (Figure 6).

3.5. Emodin Inhibited the Expression of MCP-1 and CCL7

MCP-1 and CCL7 are the prime monocyte chemotactic factor [8, 18–20]. Mice in CCl₄ group have strongly increased hepatic expression of MCP-1 and CCL7, which may be responsible for increasing numbers of intrahepatic Gr1^hi monocytes (Figure 7). However, it is obvious that emodin effectively inhibited the hepatic expression of MCP-1 and CCL7 (Figure 7), which may explain why emodin could reduce the infiltration of monocytes.

4. Discussion

Hepatic macrophages, especially monocyte-derived macrophages, hold a central position in the pathogenesis of chronic liver injury and have been proposed as potential targets for liver fibrosis [13, 22, 29]. In acute and chronic liver injury, Gr1^hi monocytes will firstly be recruited into inflammatory region and release proinflammatory and profibrogenic cytokines which will aggravate liver inflammation and fibrosis of liver [8, 17]. In the present study, we confirmed that, after repeated CCl₄ injections, Gr1^hi monocytes were markedly increased in the liver tissues of mice.

Pharmacological inhibition of Gr1^hi hepatic monocytes may be capable of limiting chronic liver injury and fibrosis in vivo [30]. Emodin, as a major active component of Rheum palmatum L. and Polygonum cuspidatum, has been reported to have anti-inflammatory, antitumor, and antifibrotic effect [24, 25]. Emodin can ameliorate hepatic steatosis through endoplasmic reticulum-stress sterol regulatory element-binding protein 1c pathway in liquid fructose-feeding rats [31]. Liu et al. also reported that emodin could ameliorate liver steatosis and decrease hepatic triglyceride in mice fed with ethanol [32]. In addition, emodin could also significantly inhibit the growth of HSC-T6 cells in vitro [33]. Emodin can also protect the rat liver from CCl₄-induced liver fibrosis by inhibiting HSCs activation in vivo [27]. In the present study, we also confirmed that emodin could reduce liver inflammation and fibrosis in mouse model induced by CCl₄. Recent studies show that emodin can inhibit homologous lymphotoxins-induced monocytes migration [34]. On this basis, we used immunohistochemistry staining and flow cytometry to observe the changes of monocytes, especially Gr1^hi monocytes. We found that emodin significantly reduced the infiltration of Gr1^hi monocytes which is novel mechanism of the antifibrotic effect of emodin.

Gr1^hi monocytes can release many proinflammatory and profibrogenic cytokines, including TNF-α, IL-1β, GRN, and TGF-β1. TNF-α and IL-1β are mainly from monocytes and macrophages in the acute and chronic liver injury [35] and may trigger the production of many other proinflammatory cytokines and induce hepatocyte death through the recruitment of neutrophils [36, 37]. TGF-β1 is considered to be the most potent profibrogenic cytokine [38, 39]. TGF-β1 can promote liver fibrosis through multiple pathways, for example, activating HSCs, stimulating collagen gene transcription, and suppressing the expression of matrix metalloproteinases [40]. TGF-β1 mainly comes from monocyte-derived macrophages [29, 40]. GRNs is a family of protein growth factors that are involved in cell proliferation. Macrophage-secreted granulin may activate resident HSCs into myofibroblasts resulting in a fibrotic microenvironment [7]. In our present study, we found that the hepatic expression of proinflammatory and profibrogenic cytokines IL-1β, IL-6, TNF-α, TGF-β1, and GRN was significantly increased following CCl₄ injection. However, emodin administration was able to decrease the hepatic expression of IL-1β, TNF-α, GRN, and TGF-β1 in the liver fibrosis model, which also explains why emodin can alleviate liver inflammation and fibrosis.

CCL7 and MCP-1 are the major cytokines for the recruitment of Gr1^hi monocytes in the liver [41, 42]. MCP-1 has been well studied in liver fibrosis. In acute and chronic liver injury, MCP-1 can induce liver fibrosis through recruitment of Gr1^hi monocytes [28]. In the present study, we also found that the hepatic expression of MCP-1 was significantly higher in the CCl₄ group as compared with the control group. In Balb/C mice fed on the methionine/choline-deficient diet, a lack of MCP-1 was associated with lower ALT levels and reduced infiltration of inflammatory cells, together with a lower degree of liver fibrosis [43]. Pharmacological inhibition of MCP-1 by mNOX-E36 can also significantly reduce the infiltration of Gr1^hi monocytes in the process of acute and chronic liver injury and can reduce the degree of liver fibrosis in vivo [21, 30, 44]. CCL7, previously known as monocyte chemotactic protein-3, belongs to the MCP subfamily of CCLs. CCL7 is expressed at multiple sites of inflammation and is produced by monocytes, fibroblasts, endothelial cells, and mast cells [45–48]. Compared to MCP-1-deficient mice, CCL7-deficient mice showed less infiltration of monocytes in the encephalitis model caused by West Nile virus infection, which indicates that CCL7 has a stronger chemotactic activity than that of MCP-1 [49]. Inhibition of CCL7 could significantly reduce the infiltration of monocytes/macrophages to lung tissues of mice infected with rhinovirus [50]. Our study also found that MCP-1 and CCL7 expression increased significantly during liver fibrosis, suggesting that MCP-1 and CCL7 may play important roles in liver fibrosis. After emodin treatment, the hepatic expression of MCP-1 and CCL7 was significantly reduced which was in line with the reduction of Gr1^hi monocytes infiltration. However, the related mechanisms regarding how emodin reduces the secretion of MCP-1 and CCL7 needs further investigation.

In conclusion, we found that emodin has inhibitory effects on liver fibrosis, which may be associated with reducing the Gr1^hi monocytes infiltration by the inhibition of MCP-1 and CCL7. These results suggest that emodin may be considered a promising candidate in the prevention and treatment of liver fibrosis. However, the clinical effect of emodin on liver fibrosis deserves further investigation.

Figure 1

Emodin attenuated CCl₄-caused liver inflammation. (a) ALT and AST levels of mice in each group. (b) Hematoxylin-eosin staining of the liver tissues. All data are expressed as the mean ± SEM. ^∗P < 0.05; ^∗∗P < 0.01. Original magnification: ×100; bar = 50 μm.

Figure 2

Emodin reduced CCl₄-caused liver fibrosis in mice. (a) Masson staining, α-SMA staining, and collagen-I staining of the liver tissues. (b) Statistical analyses of collagen deposition. All data are expressed as the mean ± SEM. ^∗P < 0.05; ^∗∗P < 0.01. Original magnification: ×100; bar = 50 μm.

Figure 3

Emodin reduced infiltrations of leukocytes, monocytes, and macrophages in liver fibrosis. (a) Immunohistochemistry staining of leukocytes, monocytes, and macrophages in the liver tissues. (b) Statistical analyses of leukocytes, monocytes, and macrophages. All data are expressed as the mean ± SEM. ^∗P < 0.05; ^∗∗P < 0.01. Original magnification: ×400; bar = 200 μm.

Figure 4

Emodin reduced infiltrations of Gr1^hi monocytes in liver fibrosis. (a) Gating strategy of Gr1^hi monocytes for flow cytometric analysis. (b) Proportions of Gr1^hi monocytes in the liver tissues. All data are expressed as the mean ± SEM. ^∗P < 0.05; ^∗∗P < 0.01. Original magnification: ×400; bar = 200 μm.

Figure 5

Emodin inhibited Gr1^hi monocyte associated proinflammatory cytokines. All data are expressed as the mean ± SEM. ^∗∗P < 0.01; ^∗P < 0.05.

Figure 6

Emodin inhibited the Gr1^hi monocyte associated profibrogenic cytokines. (a) Immunohistochemical staining of GRN and TGF-β1 in the liver tissues. (b) Hepatic mRNA expression of GRN and TGF-β1 in the liver tissues. All data are expressed as the mean ± SEM. ^∗∗P < 0.01; ^∗P < 0.05. Original magnification: ×400; bar = 200 μm.

Figure 7

Emodin inhibited the expression of chemokines MCP-1 and CCL7. (a) Immunohistochemical staining of MCP-1 and CCL7 in the liver tissues. (b) Hepatic mRNA expression of MCP-1 and CCL7. All data are expressed as the mean ± SEM. ^∗∗P < 0.01; ^∗P < 0.05. Original magnification: ×400; bar = 200 μm.

Table 1

Sequences of primers used for real-time PCR [28].

Gene	Direction	Primer sequence (5′-3′)
TGF-β1	Forward	GTGGAAATCAACGGGATCAG
TGF-β1	Reverse	ACTTCCAACCCAGGTCCTTC
GRN	Forward	GCTACAGACTTAAGGAACTC
GRN	Reverse	GAAATGGCAGTTTGATACGG
MCP-1	Forward	ATTGGGATCATCTTGCTGGT
MCP-1	Reverse	CCTGCTGTTCACAGTTGCC
CCL7	Forward	CGTCCCGTAGACAAAATGGTGAA
CCL7	Reverse	GCCGTGAGTGGAGTCATACTGGAACA
IL-1β	Forward	GGTCAAAGGTTTGGAAGCAG
IL-1β	Reverse	TGTGAAATGCCACCTTTTGA
IL-6	Forward	CATTTCCACGATTTCCCAGA
IL-6	Reverse	TCCCTCTGTGATCTGGGAAG
TNF-α	Forward	AGGGTCTGGGCCATAGAACT
TNF-α	Reverse	CCACCACGCTCTTCTGTCTAC
β-Actin	Forward	GGCTGTATTCCCCTCCATCG
β-Actin	Reverse	CCAGTTGGTAACAATGCCATGT

Acknowledgments

The study was supported from the National Natural Science Foundation of China (81672025 and 81702011), Medical Science and Technology Development Foundation of Nanjing (ZDX16004 and YKK16118), Nanjing Science and Technology Development Plan (201503016), Jiangsu Provincial Medical Innovation Team (CXTDA2017005), Natural Science Foundation of Jiangsu Province for Young Scholar (BK20160121), and Nanjing Medical Science and Technique Development Foundation (QRX17121).

Conflicts of Interest

The authors have declared that no conflicts of interest exist regarding the publication of this paper.

Authors' Contributions

Xiang-An Zhao and Guangmei Chen contributed equally to this work.

References

1. BatallerR.BrennerD. A.Liver fibrosisThe Journal of Clinical Investigation20051152209218[PubMed][Google Scholar]
2. Altamirano-BarreraA.Barranco-FragosoB.Méndez-SánchezN.Management strategies for liver fibrosisAnnals of Hepatology20171614856[PubMed][Google Scholar]
3. GuoJ.FriedmanS. L.Hepatic fibrogenesisSeminars in Liver Disease2007274413426[PubMed][Google Scholar]
4. AdhyatmikaA.PutriK. S.BeljaarsL.MelgertB. N.The Elusive Antifibrotic MacrophageFrontiers in Medicine20152, article 81[PubMed][Google Scholar]
5. JuC.TackeF.Hepatic macrophages in homeostasis and liver diseases: from pathogenesis to novel therapeutic strategiesCellular & Molecular Immunology2016133316327[PubMed][Google Scholar]
6. RobinsonM. W.HarmonC.O'FarrellyC.Liver immunology and its role in inflammation and homeostasisCellular & Molecular Immunology2016133267276[PubMed][Google Scholar]
7. NielsenS. R.QuarantaV.LinfordA.Macrophage-secreted granulin supports pancreatic cancer metastasis by inducing liver fibrosisNature Cell Biology2016185549560[PubMed][Google Scholar]
8. KarlmarkK. R.WeiskirchenR.ZimmermannH. W.Hepatic recruitment of the inflammatory Gr1⁺ monocyte subset upon liver injury promotes hepatic fibrosisHepatology2009501261274[PubMed][Google Scholar]
9. PradereJ.KluweJ.de MinicisS.Hepatic macrophages but not dendritic cells contribute to liver fibrosis by promoting the survival of activated hepatic stellate cells in miceHepatology201358414611473[PubMed][Google Scholar]
10. LiaskouE.ZimmermannH. W.LiK.-K.Monocyte subsets in human liver disease show distinct phenotypic and functional characteristicsHepatology2013571385398[PubMed][Google Scholar]
11. ZimmermannH. W.SeidlerS.NattermannJ.Functional contribution of elevated circulating andhepatic non-classical CD14+CD16+ monocytes to inflammation and human liver fibrosisPLoS ONE201056[PubMed][Google Scholar]
12. WeiskirchenR.TackeF.Liver Fibrosis: From Pathogenesis to Novel TherapiesDigestive Diseases2016344410422[PubMed][Google Scholar]
13. WynnT. A.BarronL.Macrophages: master regulators of inflammation and fibrosisSeminars in Liver Disease2010303245257[PubMed][Google Scholar]
14. MelinoM.GaddV. L.AlexanderK. A.Spatiotemporal characterization of the cellular and molecular contributors to liver fibrosis in a murine hepatotoxic-injury modelThe American Journal of Pathology20161863524538[PubMed][Google Scholar]
15. BeattieL.SawtellA.MannJ.Bone marrow-derived and resident liver macrophages display unique transcriptomic signatures but similar biological functionsJournal of Hepatology2016654758768[PubMed][Google Scholar]
16. ScottC. L.ZhengF.De BaetselierP.Bone marrow-derived monocytes give rise to self-renewing and fully differentiated Kupffer cellsNature Communications20167[PubMed][Google Scholar]
17. BrempelisK. J.CrispeI. N.Infiltrating monocytes in liver injury and repairClinical & Translational Immunology2016511, article e113[PubMed][Google Scholar]
18. SekiE.de MinicisS.InokuchiS.CCR2 promotes hepatic fibrosis in miceHepatology2009501185197[PubMed][Google Scholar]
19. ImamuraM.OgawaT.SasaguriY.ChayamaK.UenoH.Suppression of macrophage infiltration inhibits activation of hepatic stellate cells and liver fibrogenesis in ratsGastroenterology20051281138146[PubMed][Google Scholar]
20. MitchellC.CoutonD.CoutyJ.-P.Dual role of CCR2 in the constitution and the resolution of liver fibrosis in miceThe American Journal of Pathology2009174517661775[PubMed][Google Scholar]
21. EhlingJ.BartneckM.WeiX.CCL2-dependent infiltrating macrophages promote angiogenesis in progressive liver fibrosisGut2014631219601971[PubMed][Google Scholar]
22. TackeF.ZimmermannH. W.Macrophage heterogeneity in liver injury and fibrosisJournal of Hepatology201460510901096[PubMed][Google Scholar]
23. YouS.ZhouM.XueB.A clinical study on bing gan ling oral liquid for treatment of hepatitis CJ. Tradit. Chin. Med1998183209214[PubMed][Google Scholar]
24. DongX.FuJ.YinX.Emodin: A Review of its Pharmacology, Toxicity and PharmacokineticsPhytotherapy Research201630812071218[PubMed][Google Scholar]
25. LinW.-F.WangC.LingC.-Q.Research progress in anti-tumor effect of emodinZhongguo Zhongyao Zazhi2015402039373940[PubMed][Google Scholar]
26. GaoR.ChenR.CaoY.Emodin suppresses TGF-β1-induced epithelial-mesenchymal transition in alveolar epithelial cells through Notch signaling pathwayToxicology and Applied Pharmacology201731817[PubMed][Google Scholar]
27. DongM.-X.JiaY.ZhangY.-B.Emodin protects rat liver from CCl4-induced fibrogenesis via inhibition of hepatic stellate cells activationWorld Journal of Gastroenterology2009153847534762[PubMed][Google Scholar]
28. MiuraK.YangL.van RooijenN.OhnishiH.SekiE.Hepatic recruitment of macrophages promotes nonalcoholic steatohepatitis through CCR2American Journal of Physiology-Gastrointestinal and Liver Physiology201230211G1310G1321[PubMed][Google Scholar]
29. SicaA.InvernizziP.MantovaniA.Macrophage plasticity and polarization in liver homeostasis and pathologyHepatology201459520342042[PubMed][Google Scholar]
30. BaeckC.WeiX.BartneckM.Pharmacological inhibition of the chemokine C-C motif chemokine ligand 2 (monocyte chemoattractant protein 1) accelerates liver fibrosis regression by suppressing Ly-6C+ macrophage infiltration in miceHepatology201459310601072[PubMed][Google Scholar]
31. LiX.XuZ.WangS.Emodin ameliorates hepatic steatosis through endoplasmic reticulum-stress sterol regulatory element-binding protein 1c pathway in liquid fructose-feeding ratsHepatology Research2016463E105E117[PubMed][Google Scholar]
32. LiuY.ChenX.QiuM.ChenW.ZengZ.ChenY.Emodin ameliorates ethanol-induced fatty liver injury in micePharmacology2014947177[PubMed][Google Scholar]
33. PanT.-L.WangP.-W.HuangC.-H.Herbal formula, Scutellariae radix and Rhei rhizoma attenuate dimethylnitrosamine-induced liver fibrosis in a rat modelScientific Reports20155[PubMed][Google Scholar]
34. HeoS.-K.YunH.-J.NohE.-K.ParkS.-D.Emodin and rhein inhibit LIGHT-induced monocytes migration by blocking of ROS productionVascular Pharmacology2010531-22837[PubMed][Google Scholar]
35. EngeleM.StößelE.CastiglioneK.Induction of TNF in human alveolar macrophages as a potential evasion mechanism of virulent Mycobacterium tuberculosisThe Journal of Immunology2002168313281337[PubMed][Google Scholar]
36. ItoH.AndoK.IshikawaT.Role of TNF-α produced by nonantigen-specific cells in a fulminant hepatitis mouse modelThe Journal of Immunology20091821391397[PubMed][Google Scholar]
37. ZimmermannH. W.SeidlerS.GasslerN.Interleukin-8 is activated in patients with chronic liver diseases and associated with hepatic macrophage accumulation in human liver fibrosisPLoS ONE201166[PubMed][Google Scholar]
38. Hernandez-GeaV.FriedmanS. L.Pathogenesis of liver fibrosisAnnual Review of Pathology: Mechanisms of Disease20116425456[PubMed][Google Scholar]
39. InagakiY.HigashiyamaR.HigashiK.Novel anti-fibrotic modalities for liver fibrosis: molecular targeting and regenerative medicine in fibrosis therapyJournal of Gastroenterology and Hepatology201227supplement 28588[PubMed][Google Scholar]
40. HeymannF.HammerichL.StorchD.Hepatic macrophage migration and differentiation critical for liver fibrosis is mediated by the chemokine receptor C-C motif chemokine receptor 8 in miceHepatology2012553898909[PubMed][Google Scholar]
41. XuanW.QuQ.ZhengB.XiongS.FanG.-H.The chemotaxis of M1 and M2 macrophages is regulated by different chemokinesJournal of Leukocyte Biology20159716169[PubMed][Google Scholar]
42. MarraF.TackeF.Roles for chemokines in liver diseaseGastroenterology20141473577594[PubMed][Google Scholar]
43. GalastriS.ZamaraE.MilaniS.Lack of CC chemokine ligand 2 differentially affects inflammation and fibrosis according to the genetic background in a murine model of steatohepatitisClinical Science20121237459471[PubMed][Google Scholar]
44. BaeckC.WehrA.KarlmarkK. R.Pharmacological inhibition of the chemokine CCL2 (MCP-1) diminishes liver macrophage infiltration and steatohepatitis in chronic hepatic injuryGut2012613416426[PubMed][Google Scholar]
45. MentenP.WuytsA.Van DammeJ.Monocyte chemotactic protein-3European Cytokine Network2001124554560[PubMed][Google Scholar]
46. ChengJ. W.SadeghiZ.LevineA. D.The role of CXCL12 and CCL7 chemokines in immune regulation, embryonic development, and tissue regenerationCytokine2014692277283[PubMed][Google Scholar]
47. ProostP.WuytsA.Van DammeJ.Human monocyte chemotactic proteins-2 and -3: Structural and functional comparison with MCP-1Journal of Leukocyte Biology19965916774[PubMed][Google Scholar]
48. JacobssonB.HolstR.-M.AnderssonB.HagbergH.Monocyte chemotactic protein-2 and -3 in amniotic fluid: Relationship to microbial invasion of the amniotic cavity, intra-amniotic inflammation and preterm deliveryActa Obstetricia et Gynecologica Scandinavica2005846566571[PubMed][Google Scholar]
49. BardinaS. V.MichlmayrD.HoffmanK. W.Differential roles of chemokines CCL2 and CCL7 in monocytosis and leukocyte migration during West Nile virus infectionThe Journal of Immunology2015195943064318[PubMed][Google Scholar]
50. GirkinJ.HatchwellL.FosterP.CCL7 and IRF-7 mediate hallmark inflammatory and IFN responses following rhinovirus 1B infectionThe Journal of Immunology20151941049244930[PubMed][Google Scholar]

Emodin Alleviates Liver Fibrosis of Mice by Reducing Infiltration of Gr1hi Monocytes