Membrane transporters and channels (collectively the transportome) govern cellular influx and efflux of ions, nutrients, and drugs. We used oligonucleotide arrays to analyze gene expression of the transportome in 60 human cancer cell lines used by the National Cancer Institute for drug screening. Correlating gene expression with the potencies of 119 standard anticancer drugs identified known drug-transporter interactions and suggested novel ones. Folate, nucleoside, and amino acid transporters positively correlated with chemosensitivity to their respective drug substrates. We validated the positive correlation between SLC29A1 (nucleoside transporter ENT1) expression and potency of nucleoside analogues, azacytidine and inosine-glycodialdehyde. Application of an inhibitor of SLC29A1, nitrobenzylmercaptopurine ribonucleoside, significantly reduced the potency of these two drugs, indicating that SLC29A1 plays a role in cellular uptake. Three ABC efflux transporters (ABCB1, ABCC3, and ABCB5) showed significant negative correlations with multiple drugs, suggesting a mechanism of drug resistance. ABCB1 expression correlated negatively with potencies of 19 known ABCB1 substrates and with Baker's antifol and geldanamycin. Use of RNA interference reduced ABCB1 mRNA levels and concomitantly increased sensitivity to these two drugs, as expected for ABCB1 substrates. Similarly, specific silencing of ABCB5 by small interfering RNA increased sensitivity to several drugs in melanoma cells, implicating ABCB5 as a novel chemoresistance factor. Ion exchangers, ion channels, and subunits of proton and sodium pumps variably correlated with drug potency. This study identifies numerous potential drug-transporter relationships and supports a prominent role for membrane transport in determining chemosensitivity. Measurement of transporter gene expression may prove useful in predicting anticancer drug response.

Heroin addiction is a chronic complex disease with a substantial genetic contribution. This study was designed to identify gene variants associated with heroin addiction in African Americans. The emphasis was on genes involved in reward modulation, behavioral control, cognitive function, signal transduction and stress response. We have performed a case-control association analysis by screening with 1350 variants of 130 genes. The sample consisted of 202 former severe heroin addicts in methadone treatment and 167 healthy controls with no history of drug abuse. Single nucleotide polymorphism (SNP), haplotype and multi-SNP genotype pattern analyses were performed. Seventeen SNPs showed point-wise significant association with heroin addiction (nominal P< 0.01). These SNPs are from genes encoding several receptors: adrenergic (ADRA1A), arginine vasopressin (AVPR1A), cholinergic (CHRM2), dopamine (DRD1), GABA-A (GABRB3), glutamate (GRIN2A) and serotonin (HTR3A) as well as alcohol dehydrogenase (ADH7), glutamic acid decarboxylase (GAD1 and GAD2), the nucleoside transporter (SLC29A1) and diazepam-binding inhibitor (DBI). The most significant result of the analyses was obtained for the GRIN2A haplotype G-A-T (rs4587976-rs1071502-rs1366076) with protective effect (P(uncorrected) = 9.6E- 05, P(corrected) = 0.058). This study corroborates several reported associations with alcohol and drug addiction as well as other related disorders and extends the list of variants that may affect the development of heroin addiction. Further studies will be necessary to replicate these associations and to elucidate the roles of these variants in drug addiction vulnerability.

To understand the mechanism of cellular resistance to the nucleoside analogue cytarabine (1-beta-D-arabinofuranosylcytosine, AraC), two resistant derivatives of the human leukemic line CCRF-CEM were obtained by stepwise selection in different concentrations of AraC. CEM/4xAraC cells showed low AraC resistance, whereas CEM/20xAraC cells showed high resistance. Both cell lines showed similar patterns of cross-resistance to multiple cytotoxic nucleoside analogues, with the exception that CEM/20xAraC cells remained sensitive to 5-fluorouridine and 2-deoxy-5-fluorouridine. Both cell lines were sensitive to 5-fluorouracil and to a variety of natural product drugs. Although both CEM/4xAraC and CEM/20xAraC cells displayed reduced intracellular accumulation of [(3)H]AraC, only CEM/4xAraC cells showed reduced uptake of [(3)H]uridine, which was used to assess nucleoside transport activities. Genes encoding proteins known to be involved in nucleoside transport, efflux, and metabolism were analyzed for the presence of mutations in the two cell lines. In CEM/4xAraC cells, independent mutations were identified at each allele of human equilibrative nucleoside transporter 1 (hENT1; SLC29A1), one corresponding to a single-nucleotide change in exon 4, the other being a complex intronic mutation disrupting splicing of exon 13. In contrast to CEM/20xAraC cells, CEM/4xAraC cells did not bind the hENT1/SLC29A1 ligand nitrobenzylmercaptopurine ribonucleoside and lacked detectable hENT1/SLC29A1 protein. In CEM/20xAraC cells, independent intronic mutations impairing splicing of exons 2 and 3 were found at each allele of the deoxycytidine kinase gene. These studies point to at least two distinct mechanisms of AraC resistance in leukemic cells.

OBJECTIVE

To determine whether insulin reverses gestational diabetes mellitus (GDM)-reduced expression and activity of human equilibrative nucleoside transporters 1 (hENT1) in human umbilical vein endothelium cells (HUVECs).

METHODS

Primary cultured HUVECs from full-term normal (n = 44) and diet-treated GDM (n = 44) pregnancies were used. Insulin effect was assayed on hENT1 expression (protein, mRNA, SLC29A1 promoter activity) and activity (initial rates of adenosine transport) as well as endothelial nitric oxide (NO) synthase activity (serine(1177) phosphorylation, l-citrulline formation). Adenosine concentration in culture medium and umbilical vein blood (high-performance liquid chromatography) as well as insulin receptor A and B expression (quantitative PCR) were determined. Reactivity of umbilical vein rings to adenosine and insulin was assayed by wire myography. Experiments were in the absence or presence of l-N(G)-nitro-l-arginine methyl ester (l-NAME; NO synthase inhibitor) or ZM-241385 (an A(2A)-adenosine receptor antagonist).

RESULTS

Umbilical vein blood adenosine concentration was higher, and the adenosine- and insulin-induced NO/endothelium-dependent umbilical vein relaxation was lower in GDM. Cells from GDM exhibited increased insulin receptor A isoform expression in addition to the reported NO-dependent inhibition of hENT1-adenosine transport and SLC29A1 reporter repression, and increased extracellular concentration of adenosine and NO synthase activity. Insulin reversed all these parameters to values in normal pregnancies, an effect blocked by ZM-241385 and l-NAME.

CONCLUSIONS

GDM and normal pregnancy HUVEC phenotypes are differentially responsive to insulin, a phenomenon where insulin acts as protecting factor for endothelial dysfunction characteristic of this syndrome. Abnormal adenosine plasma levels, and potentially A(2A)-adenosine receptors and insulin receptor A, will play crucial roles in this phenomenon in GDM.

Human endothelial dysfunction is a common feature in many diseases of pregnancy, such as gestational diabetes (GD). Metabolic changes include abnormal synthesis of nitric oxide (NO) and abnormal membrane transport of l-arginine and adenosine in primary cultures of human umbilical vein (HUVEC, macrovascular) and placental microvillus (hPMEC, microvascular) endothelial cells. These alterations are associated with modifications in the expression and activity of endothelial (eNOS) and inducible (iNOS) NO synthases, respectively, an effect that is maintained at least up to passage 5 in culture. HUVEC and hPMEC exhibit expression and activity of the human cationic amino acid transporter 1 (hCAT-1), equilibrative nucleoside transporters 1 (hENT1) and hENT2, as well as the corresponding SLC7A1, SLC29A1 and SLC29A2 gene promoter activities. Altered gene expression results from increased NO level, protein kinase C, mitogen-activated protein kinases, and hCHOP-C/EBPα transcription factor activation. Reduced ENT-mediated adenosine transport in GD is associated with stimulation of the l-arginine/NO pathway, and mainly due to reduced expression and activity of hENT1. In addition, hENT2 activity seems able to restore the reduced adenosine transport in GD. Additionally, insulin exerts a differential modulation of endothelial cells from macrocirculation compared with microcirculation, possibly due to expression of different insulin receptor isoforms. It is suggested that a common functional characteristic leading to changes in the bioavailability of adenosine and metabolism of l-arginine is evidenced by human fetal micro and macrovascular endothelium in GD.

Systemic disposition of nucleosides and nucleoside analogs is dependent on renal handling of these compounds. There are five known, functionally characterized nucleoside transporters with varying substrate specificities for nucleosides: concentrative nucleoside transporters (CNT1-CNT3; Solute Carrier (SLC) 28A1-28A3), which mediate the intracellular flux of nucleosides, and equilibrative nucleoside transporters (ENT1-ENT2; SLC29A1-SLC29A2), which mediate bi-directional facilitated diffusion of nucleosides. All five of these transporters are expressed in the kidney. Concentrative nucleoside transporters primarily localize to the apical membrane of renal epithelial cells while equilibrative nucleoside transporters primarily localize to the basolateral membrane. These transporters work in concert to mediate reabsorptive flux of naturally occurring nucleosides and nucleoside analogs. In addition, equilibrative transporters also participate in secretory flux of some nucleoside analogs. Nucleoside transporters also serve in the targeting of nucleoside analog therapies to renal tumors. This review examines the role that these transporters play in renal disposition of nucleosides and nucleoside analogs in both systemic and kidney-specific therapies.

Thirty-nine genetic variations, including thirty novel ones, were found in the human SLC29A1 gene, which encodes equilibrative nucleoside transporter 1, from 256 Japanese cancer patients administered gemcitabine. The found novel variations included -8,166G>A, -81,10A>G, -7,947G>A, -7,789T>C, -5,595G>A, -3,803_-3,783delTCGGGGAGGTGGCAGTGGGCG, -3,548G>C, -3,414G>A, -1355T>C, -34C>G, IVS1+141G>A, IVS1+260C>T, IVS1-82C>T, 177C>G, IVS3-6C>T, 564C>T, IVS8+44T>C, IVS8+90T>C, IVS8+97T>C, IVS8+131C>T, IVS8+169G>A, 933T>C, 954C>T, IVS11-52G>C, IVS11-46G>A, 1,288G>A, 1,641C>G, 1,703_1,704delGT, 1812C>T, and 1861C>T. The frequencies were 0.051 for IVS8+169G>A, 0.012 for -7,947G>A, 0.006 for IVS1+141G>A and 1,703_1,704delGT, 0.004 for -8,166G>A, -8,110A>G, -3,548G>C, -1,355T>C, -34C>G, IVS8+44T>C, and 1,812C>T, and 0.002 for the other 19 variations. Among them, 177C>G and 1,288G>A resulted in amino acid substitutions Asp59Glu and Ala430Thr, respectively. Using the detected polymorphisms, linkage disequilibrium analysis was performed, and 28 haplotypes were identified or inferred. Our findings would provide fundamental and useful information for genotyping SLC29A1 in the Japanese and probably other Asian populations.

BACKGROUND

Different DNA aberrations processes can cause colorectal cancer (CRC). Herein, we conducted a comprehensive molecular characterization of 27 CRCs from Iranian patients.

METHODS

Array CGH was performed. The MSI phenotype and the methylation status of 15 genes was established using MSP. The CGH data was compared to two established lists of 41 and 68 cancer genes, respectively, and to CGH data from African Americans. A maximum parsimony cladogram based on global aberrations was established.

RESULTS

The number of aberrations seem to depend on the MSI status. MSI-H tumors displayed the lowest number of aberrations. MSP revealed that most markers were methylated, except RNF182 gene. P16 and MLH1 genes were primarily methylated in MSI-H tumors. Seven markers with moderate to high frequency of methylation (SYNE1, MMP2, CD109, EVL, RET, LGR and PTPRD) had very low levels of chromosomal aberrations. All chromosomes were targeted by aberrations with deletions more frequent than amplifications. The most amplified markers were CD248, ERCC6, ERGIC3, GNAS, MMP2, NF1, P2RX7, SFRS6, SLC29A1 and TBX22. Most deletions were noted for ADAM29, CHL1, CSMD3, FBXW7, GALNS, MMP2, NF1, PRKD1, SMAD4 and TP53. Aberrations targeting chromosome X were primarily amplifications in male patients and deletions in female patients. A finding similar to what we reported for African American CRC patients.

CONCLUSIONS

This first comprehensive analysis of CRC Iranian tumors reveals a high MSI rate. The MSI tumors displayed the lowest level of chromosomal aberrations but high frequency of methylation. The MSI-L were predominantly targeted with chromosomal instability in a way similar to the MSS tumors. The global chromosomal aberration profiles showed many similarities with other populations but also differences that might allow a better understanding of CRC's clinico-pathological specifics in this population.

OBJECTIVE

The aim of this study was to investigate the prognostic significance of fourteen anticancer drug-relevant solute carrier transporters (SLCs) in pancreatic cancer in the context of clinical-pathological characteristics and the KRAS mutation status of tumors.

METHODS

Tumors and non-neoplastic pancreatic tissues were obtained from 32 histologically verified patients with pancreatic ductal adenocarcinoma. The transcript profile of SLCs was assessed using quantitative real-time PCR. KRAS mutations in exon 2 were assessed by high-resolution melting analysis and confirmed by sequencing.

RESULTS

SLC22A3 and SLC22A18 were upregulated and SLC22A1, SLC22A2, SLC22A11, SLC28A1, SLC28A3 and SLC29A1 were downregulated when compared with non-neoplastic pancreatic tissues. Moreover, significantly lower levels of SLC22A1, SLC22A11 and SLC29A1 were found in tumors with angioinvasion. There was also a significantly higher transcript level of SLC28A1 in tumors with regional lymph nodes affected by metastasis. The study found that a high expression of SLC28A1 was significantly associated with poor overall survival in unselected patients. In contrast, a high expression of SLC22A3 or SLC29A3 was significantly associated with longer overall survival in patients treated with nucleoside analogs. Protein expression of SLC22A1, SLC22A3 and SLC29A3 in tumor tissues of patients with pancreatic carcinoma was observed by immunoblotting for the first time. Finally, SLC levels were not found to be associated with KRAS mutation status in exon 2.

CONCLUSIONS

This study identified a number of associations of transcript levels of SLCs with prognosis of pancreatic cancer patients.

BACKGROUND

Standard-dose ribavirin is crucial for the standard-of-care treatment of chronic hepatitis C virus (HCV) infection. Equilibrative nucleoside transporter 1 (ENT1), encoded by SLC29A1 gene, is the main transporter that imports ribavirin into human hepatocytes.

OBJECTIVE

To determine whether single nucleotide polymorphisms (SNPs) at the SLC29A1 gene could influence the probability of treatment response compared with other baseline and host genetic factors.

METHODS

A total of 526 East Asian patients monoinfected with HCV genotype 1b who had received pegylated interferon alpha plus ribavirin therapy were enrolled in this study. They were assigned randomly to the derivation and confirmatory groups. SNPs related to the IL28B, ITPA and SLC29A1 genes were genotyped using real-time detection polymerase chain reaction. Factors associated with sustained virological response (SVR) were analysed using multiple logistic regression analysis.

RESULTS

Multivariate analysis for the derivation group identified six baseline variables significantly and independently associated with SVR: age [P = 0.023, odds ratio (OR) = 0.97], gender (P = 0.0047, OR = 2.25), platelet count (P = 0.00017, OR = 1.11), viral load (P = 0.00026, OR = 0.54), IL28B SNP rs12979860 (P = 1.09 × 10(-7) , OR = 8.68) and SLC29A1 SNP rs6932345 (P = 0.030, OR = 1.85). Using the model constructed by these independent variables, positive and negative predictive values and predictive accuracy were 73.3, 70.1 and 71.9% respectively. For the confirmatory group, they were 71.4, 84.6 and 75.3% respectively. The SLC29A1 and IL28B SNPs were also significantly associated with rapid virological response.

CONCLUSIONS

The SNP at the major ribavirin transporter ENT1 gene SLC29A1 was one of significantly independent factors influencing treatment response, although the impact on the prediction was small.

BACKGROUND

Adenosine is involved in several neurological and behavioral disorders including alcoholism. In cultured cell and animal studies, type 1 equilibrative nucleoside transporter (ENT1, slc29a1), which regulates adenosine levels, is known to regulate ethanol sensitivity and preference. Interestingly, in humans, the ENT1 (SLC29A1) gene contains a non-synonymous single nucleotide polymorphism (647 T/C; rs45573936) that might be involved in the functional change of ENT1.

RESULTS

Our functional analysis showed that prolonged ethanol exposure increased adenosine uptake activity of mutant cells (ENT1-216Thr) compared to wild-type (ENT1-216Ile) transfected cells, which might result in reduced extracellular adenosine levels. We found that mice lacking ENT1 displayed increased propensity to ethanol withdrawal seizures compared to wild-type littermates. We further investigated a possible association of the 647C variant with alcoholism and the history of alcohol withdrawal seizures in subjects of European ancestry recruited from two independent sites. Analyses of the combined data set showed an association of the 647C variant and alcohol dependence with withdrawal seizures at the nominally significant level.

CONCLUSIONS

Together with the functional data, our findings suggest a potential contribution of a genetic variant of ENT1 to the development of alcoholism with increased risk of alcohol withdrawal-induced seizures in humans.

OBJECTIVE

Gemcitabine (2',2'-difluorodeoxycytidine) is an anticancer drug, which is effective against solid tumours, including non-small-cell lung cancer and pancreatic cancer. After gemcitabine is transported into cells by equilibrative and concentrative nucleoside transporters, it is phosphorylated by deoxycytidine kinase (DCK) and further phosphorylated to its active diphosphorylated and triphosphorylated forms. Gemcitabine is rapidly metabolized by cytidine deaminase (CDA) to an inactive metabolite, 2',2'-difluorodeoxyuridine (dFdU), which is excreted into the urine. Toxicities of gemcitabine are generally mild, but unpredictable severe toxicities such as myelosuppression and interstitial pneumonia are occasionally encountered. The aim of this study was to determine the factors, including genetic polymorphisms of CDA, DCK and solute carrier family 29A1 (SLC29A1 [hENT1]), that alter the pharmacokinetics of gemcitabine in Japanese cancer patients.

METHODS

250 Japanese cancer patients who received 30-minute intravenous infusions of gemcitabine at 800 or 1000 mg/m2 in the period between September 2002 and July 2004 were recruited for this study. However, four patients were excluded from the final model built in this study because they showed bimodal concentration-time curves. Two patients who experienced gemcitabine-derived life-threatening toxicities in October 2006 and January 2008 were added to this analysis. One of these patients received 30-minute intravenous infusions of gemcitabine at 454 mg/m2 instead of the usual dose (1000 mg/m2). Plasma concentrations of gemcitabine and dFdU were measured by high-performance liquid chromatography-photodiode array/mass spectrometry. In total, 1973 and 1975 plasma concentrations of gemcitabine and dFdU, respectively, were used to build population pharmacokinetic models using nonlinear mixed-effects modelling software (NONMEM version V level 1.1).

CONCLUSIONS

Two-compartment models fitted well to plasma concentration-time curves for both gemcitabine and dFdU. Major contributing factors for gemcitabine clearance were genetic polymorphisms of CDA, including homozygous CDA*3 [208G>A (Ala70Thr)] (64% decrease), heterozygous *3 (17% decrease) and CDA -31delC (an approximate 7% increase per deletion), which has a strong association with CDA*2 [79A>C (Lys27Gln)], and coadministered S-1, an oral, multicomponent anti-cancer drug mixture consisting of tegafur, gimeracil and oteracil (an approximate 19% increase). The estimated contribution of homozygous CDA*3 to gemcitabine clearance provides an explanation for the life-threatening severe adverse reactions, including grade 4 neutropenia observed in three Japanese patients with homozygous CDA*3. Genetic polymorphisms of DCK and SLC29A1 (hENT1) had no significant correlation with gemcitabine pharmacokinetic parameters. Aging and increased serum creatinine levels correlated with decreased dFdU clearance.

CONCLUSIONS

A population pharmacokinetic model that included CDA genotypes as a covariate for gemcitabine and dFdU in Japanese cancer patients was successfully constructed. The model confirms the clinical importance of the CDA*3 genotype.

OBJECTIVE

Reduced expression of human equilibrative nucleoside transporter 1 (hENT1) results from nitric oxide (NO)-dependent reduced SLC29A1 transcriptional activity in human umbilical vein endothelial cells (HUVECs) from gestational diabetes. As expression of the transcription factor C/EBP homologous protein 10 (hCHOP, which forms heterodimers with C/EBPalpha transcription factor) is activated by NO and induced in diabetes mellitus, we hypothesize that hCHOP plays a role in the gestational diabetes-reduced hENT1 expression in HUVECs.

RESULTS

HUVEC primary cultures from 42 normal and 42 gestational diabetic pregnancies were used for adenosine uptake assays. Real-time PCR (mRNA quantification), western blotting (protein abundance), and luciferase activity (SLC29A1 promoter activity) were used. hCHOP-C/EBPalpha activity was assayed by chromatin immunoprecipitation. Overlap extension mutagenesis was used to generate a mutated hCHOP-C/EBPalpha consensus site at the SLC29A1 promoter, and endothelial NO synthase (eNOS) siRNA recombinant adenovirus was used to knock down eNOS. hCHOP nuclear protein abundance and binding to DNA were higher in gestational diabetes, paralleled by reduced SLC29A1 promoter activity, hENT1 expression, and transport activity. These changes were blocked by hCHOP consensus sequence mutation (-1845G>> T and -1844C>> A), eNOS-siRNA-induced knockdown, and N(G)-nitro-L-arginine methyl ester (NOS inhibitor), and were mimicked by S-nitroso-N-acetyl-L, D-penicillamine (NO donor) in cells from normal pregnancies. hCHOP and C/EBPalpha overexpression mimicked gestational diabetes effects in cells from normal pregnancies, but did not alter SLC29A1 promoter activity or hENT1-adenosine transport in cells from gestational diabetes.

CONCLUSIONS

The hCHOP-C/EBPalpha complex down-regulates SLC29A1 expression in an NO-dependent manner in HUVECs from gestational diabetes.

To elucidate interpatient variability in thioguanine nucleotide (TGN) concentrations in acute lymphoblastic leukemia (ALL) cells, we determined the TGN concentrations in leukemic blasts from 82 children with newly diagnosed ALL after intravenous administration of mercaptopurine (MP). Patients treated with MP alone achieved higher TGN concentrations than those treated with the combination of methotrexate plus mercaptopurine (MTX + MP). Analysis of the expression of approximately 9600 genes in ALL cells obtained at diagnosis identified 60 gene probes significantly associated with TGN accumulation in patients treated with MP alone and 75 gene probes in patients treated with MTX + MP, with no overlap between the 2 sets of genes. Genes significantly associated with intracellular TGN accumulation after MP alone included those encoding MP metabolic enzymes and transporters (eg, SLC29A1). Inhibition of SLC29A1 by nitrobenzylmercaptopurine ribonucleoside (NBMPR) caused a 33% to 45% reduction of TGN in ALL cells in vitro (P < .006), consistent with the gene expression findings. Genes associated with TGN concentration after combination therapy included those involved in protein and adenosine triphosphate (ATP)-biosynthesis. Together, these in vivo and in vitro data provide new insight into the genomic basis of interpatient differences in intracellular TGN accumulation and reveal significant differences between treatment with MP alone and treatment with MP and MTX.

Renal handling of physiological and pharmacological nucleosides is a major determinant of their plasma levels and tissue availabilities. Additionally, the pharmacokinetics and normal tissue toxicities of nucleoside drugs are influenced by their handling in the kidney. Renal reabsorption or secretion of nucleosides is selective and dependent on integral membrane proteins, termed nucleoside transporters (NTs) present in renal epithelia. The 7 known human NTs (hNTs) exhibit varying permeant selectivities and are divided into 2 protein families: the solute carrier (SLC) 29 (SLC29A1, SLC29A2, SLC29A3, SLC29A4) and SLC28 (SLC28A1, SLC28A2, SLC28A3) proteins, otherwise known, respectively, as the human equilibrative NTs (hENTs, hENT1, hENT2, hENT3, hENT4) and human concentrative NTs (hCNTs, hCNT1, hCNT2, hCNT3). The well characterized hENTs (hENT1 and hENT2) are bidirectional facilitative diffusion transporters in plasma membranes; hENT3 and hENT4 are much less well known, although hENT3, found in lysosomal membranes, transports nucleosides and is pH dependent, whereas hENT4-PMAT is a H+-adenosine cotransporter as well as a monoamine-organic cation transporter. The 3 hCNTs are unidirectional secondary active Na+-nucleoside cotransporters. In renal epithelial cells, hCNT1, hCNT2, and hCNT3 at apical membranes, and hENT1 and hENT2 at basolateral membranes, apparently work in concert to mediate reabsorption of nucleosides from lumen to blood, driven by Na+ gradients. Secretion of some physiological nucleosides, therapeutic nucleoside analog drugs, and nucleotide metabolites of therapeutic nucleoside and nucleobase drugs likely occurs through various xenobiotic transporters in renal epithelia, including organic cation transporters, organic anion transporters, multidrug resistance related proteins, and multidrug resistance proteins. Mounting evidence suggests that hENT1 may have a presence at both apical and basolateral membranes of renal epithelia, and thus may participate in both selective secretory and reabsorptive fluxes of nucleosides. In this review, the renal handling of nucleosides is examined with respect to physiological and clinical implications for the regulation of human kidney NTs and adenosine signaling, intracellular nucleoside transport, and nephrotoxicities associated with some nucleoside drugs.

Colorectal cancer (CRC) is one of the most common malignant tumors worldwide. CRC molecular pathogenesis is heterogeneous and may be followed by mutations in oncogenes and tumor suppressor genes, chromosomal and microsatellite instability, alternative splicing alterations, hypermethylation of CpG islands, oxidative stress, impairment of different signaling pathways and energy metabolism. In the present work, we have studied the alterations of alternative splicing patterns of genes related to energy metabolism in CRC.

Using CrossHub software, we analyzed The Cancer Genome Atlas (TCGA) RNA-Seq datasets derived from colon tumor and matched normal tissues. The expression of 1014 alternative mRNA isoforms involved in cell energy metabolism was examined. We found 7 genes with differentially expressed alternative transcripts whereas overall expression of these genes was not significantly altered in CRC. A set of 8 differentially expressed transcripts of interest has been validated by qPCR. These eight isoforms encoded by OGDH, COL6A3, ICAM1, PHPT1, PPP2R5D, SLC29A1, and TRIB3 genes were up-regulated in colorectal tumors, and this is in concordance with the bioinformatics data. The alternative transcript NM_057167 of COL6A3 was also strongly up-regulated in breast, lung, prostate, and kidney tumors. Alternative transcript of SLC29A1 (NM_001078177) was up-regulated only in CRC samples, but not in the other tested tumor types.

We identified tumor-specific expression of alternative spliced transcripts of seven genes involved in energy metabolism in CRC. Our results bring new knowledge on alternative splicing in colorectal cancer and suggest a set of mRNA isoforms that could be used for cancer diagnosis and development of treatment methods.

The widely expressed, homo-oligomeric, lipid raft-associated, monotopic integral membrane protein stomatin and its homologues are known to interact with and modulate various ion channels and transporters. Stomatin is a major protein of the human erythrocyte membrane, where it associates with and modifies the glucose transporter GLUT1; however, previous attempts to purify hetero-oligomeric stomatin complexes for biochemical analysis have failed. Because lateral interactions of membrane proteins may be short-lived and unstable, we have used in situ chemical cross-linking of erythrocyte membranes to fix the stomatin complexes for subsequent purification by immunoaffinity chromatography. To further enrich stomatin, we prepared detergent-resistant membranes either before or after cross-linking. Mass spectrometry of the isolated, high molecular, cross-linked stomatin complexes revealed the major interaction partners as glucose transporter-1 (GLUT1), anion exchanger (band 3), and water channel (aquaporin-1). Moreover, ferroportin-1 (SLC40A1), urea transporter-1 (SLC14A1), nucleoside transporter (SLC29A1), the calcium-pump (Ca-ATPase-4), CD47, and flotillins were identified as stomatin-interacting proteins. These findings are in line with the hypothesis that stomatin plays a role as membrane-bound scaffolding protein modulating transport proteins.

OBJECTIVE

Previous preclinical studies suggested that concurrent capecitabine and radiation could be an effective new treatment modality for glioblastoma (GBM). In the current study, we investigate toxicity and response to this regimen and explore associations between gene expression and patient outcome.

METHODS

Eighteen newly diagnosed GBM patients received concurrent capecitabine at 625 mg/m2 BID (25% escalation) and irradiation (60 Gy total) for 6 weeks followed by 4 weeks of capecitabine only. Maintenance capecitabine was administered for 14 days every 3 weeks until progression or unacceptable toxicity. Expression analysis of 94 genes involved in capecitabine metabolism and radiation response was done on tissues obtained before therapy. The relationship of gene expression with time-to-progression (TTP) and overall survival (OS) was investigated using univariate Cox proportional hazards regression, semi-supervised principle component analysis, and class prediction modeling.

RESULTS

The maximum tolerated dose of capecitabine was 625 mg/m2 BID. Median patient TTP and OS were 247 and 367 days, respectively. Cox regression identified 24 genes significantly (P<0.025) associated with patient outcome. Semi-supervised principle component analysis identified two patient populations significantly different in both TTP (P=0.005) and OS (P=0.015). Class prediction modeling determined that eight genes (RAD54B, MTOR, DCTD, APEX2, TK1, RRM2, SLC29A1, and ERCC6) could collectively classify patients into outcome subgroups with 100% accuracy and precision.

CONCLUSIONS

Capecitabine and concurrent radiation for newly diagnosed GBM seems to be well tolerated and comparable to temozolomide and radiation. A gene expression profile predictive of patient outcome that may be useful in patient stratification for therapy was also elucidated.

Reduced adenosine uptake via human equilibrative nucleoside transporter 1 (hENT1) in human umbilical vein endothelial cells (HUVECs) from gestational diabetes mellitus (GDM) is reversed by insulin by restoring hENT1 expression. Insulin receptors A (IR-A) and B (IR-B) are expressed in HUVECs, and GDM results in higher IR-A mRNA expression vs. cells from normal pregnancies. We studied whether the reversal of GDM effects on transport by insulin depends on restoration of IR-A expression. We specifically measured hENT1 expression [mRNA, protein abundance, SLC29A1 (for hENT1) promoter activity] and activity (adenosine transport kinetics) and the role of IR-A/IR-B expression and signaling [total and phosphorylated 42 and 44 kDa mitogen-activated protein kinases (p44/42(mapk)) and Akt] in IR-A, IR-B, and IR-A/B knockdown HUVECs from normal (n = 33) or GDM (n = 33) pregnancies. GDM increases IR-A/IR-B mRNA expression (1.8-fold) and p44/42(mapk):Akt activity (2.7-fold) ratios. Insulin reversed GDM-reduced hENT1 expression and maximal transport capacity (V(max)/K(m)), and GDM-increased IR-A/IR-B mRNA expression and p44/42(mapk):Akt activity ratios to values in normal pregnancies. Insulin's effect was abolished in IR-A or IR-A/B knockdown cells. Thus, insulin requires normal IR-A expression and p44/42(mapk)/Akt signaling to restore GDM-reduced hENT1 expression and activity in HUVECs. This could be a protective mechanism for the placental macrovascular endothelial dysfunction seen in GDM.

BACKGROUND

Precision (Personalized) medicine has the potential to revolutionize patient health care especially for many cancers where the fundamental disease etiology remains either elusive or has no available therapy. Here we outline a study in alveolar rhabdomyosarcoma, in which we use gene expression profiling and a series of drug prediction algorithms combined with a matched patient-derived xenograft (PDX) model to test bioinformatically predicted therapies.

METHODS

A PDX model was developed from a patient biopsy and a number of drugs identified using gene expression analysis in combination with drug prediction algorithms. Drugs chosen from each of the predictive methodologies, along with the patient's standard-of-care therapy (ICE-T), were tested in vivo in the PDX tumor. A second study was initiated using the tumors that re-grew following the ICE-T treatment. Further expression analysis identified additional therapies with potential anti-tumor efficacy.

RESULTS

A number of the predicted therapies were found to be active against the tumors in particular BGJ398 (FGFR2) and ICE-T. Re-transplanted ICE-T treated tumorgrafts demonstrated a decreased response to ICE-T recapitulating the patient's refractory disease. Gene expression profiling of the ICE-T treated tumorgrafts identified cytarabine (SLC29A1) as a potential therapy, which was shown, along with BGJ398, to be highly active in vivo.

CONCLUSIONS

This study illustrates that PDX models are suitable surrogates for testing potential therapeutic strategies based on gene expression analysis, modeling clinical drug resistance and hold the potential to assist in guiding prospective patient care.

A new global pandemic of coronavirus disease 2019 (COVID-19) has resulted in high mortality and morbidity. Currently numerous drugs are under expedited investigations without well-established safety or efficacy data. Pharmacogenomics may allow individualization of these drugs thereby improving efficacy and safety. In this review, we summarized the pharmacogenomic literature available for COVID-19 drug therapies including hydroxychloroquine, chloroquine, azithromycin, remdesivir, favipiravir, ribavirin, lopinavir/ritonavir, darunavir/cobicistat, interferon beta-1b, tocilizumab, ruxolitinib, baricitinib, and corticosteroids. We searched PubMed, reviewed the Pharmacogenomics Knowledgebase (PharmGKB^®) website, Clinical Pharmacogenetics Implementation Consortium (CPIC) guidelines, the U.S. Food and Drug Administration (FDA) pharmacogenomics information in the product labeling, and the FDA pharmacogenomics association table. We found several drug-gene variant pairs that may alter the pharmacokinetics of hydroxychloroquine/chloroquine (CYP2C8, CYP2D6, SLCO1A2, and SLCO1B1); azithromycin (ABCB1); ribavirin (SLC29A1, SLC28A2, and SLC28A3); and lopinavir/ritonavir (SLCO1B1, ABCC2, CYP3A). We also identified other variants, that are associated with adverse effects, most notable in hydroxychloroquine/chloroquine (G6PD; hemolysis), ribavirin (ITPA; hemolysis), and interferon β -1b (IRF6; liver toxicity). We also describe the complexity of the risk for QT prolongation in this setting because of additive effects of combining more than one QT-prolonging drug (i.e., hydroxychloroquine/chloroquine and azithromycin), increased concentrations of the drugs due to genetic variants, along with the risk of also combining therapy with potent inhibitors. In conclusion, although direct evidence in COVID-19 patients is lacking, we identified potential actionable genetic markers in COVID-19 therapies. Clinical studies in COVID-19 patients are deemed warranted to assess potential roles of these markers.

Keywords: Genetic markers; Viral infection.

Adenosine is a candidate modulator of sperm motility in the female reproductive tract that increases sperm flagellar beat frequency in vitro. Past work suggested that this acceleration may involve equilibrative (ENT) and concentrative (CNT) nucleoside transporters. Here we show that Slc29a1 (ENT-1) is the predominant nucleoside transporter expressed in the mouse testis. Unexpectedly, the beat of Slc29a1-null sperm still accelerates in response to 2-chloro-2'-deoxyadenosine (Cl-dAdo). Moreover, in wild-type sperm neither blockade of CNTs by removal of external Na(+), nor inhibition of ENTs with nitrobenzylthioionosine, prevents acceleration of the sperm beat by Cl-dAdo. In contrast, pertussis toxin produces strong blockade, indicating involvement of a Gα(i/o)-coupled adenosine receptor. Although agonists selective for adenosine receptors A1R, A2aR, and A2bR are ineffective, A3R-selective agonists Cl-IB-MECA and IB-MECA do accelerate the beat. Consistent with this pharmacological profile, the predominant Adora transcripts in the testis are products of the nested Adora3i1 and Adora3i2 genes. Surprisingly, Cl-IB-MECA and Cl-dAdo still accelerate the beat of Adora3i1-null sperm indicating that the remaining Adora3i2 transcript produces an A3R that functions in sperm. When cloned Adora3i2 is heterologously expressed in tsA-201 cells, Cl-dAdo decreases forskolin-evoked accumulation of cAMP, indicating that Adora3i2 specifies a functional A3Ri2 adenosine receptor that couples through Gα(i). Database mining reveals that mouse Adora3i2 is expressed primarily in testis, almost exclusively in spermatids. Expression of the orthologous ADORA3i3 transcript also is most prominent in human testis; presumably producing an A3Ri3 receptor that is functional in sperm and that may be a target for development of male-directed contraceptives.

The Augustine-negative alias At(a-) blood type, which seems to be restricted to people of African ancestry, was identified half a century ago but remains one of the last blood types with no known genetic basis. Here we report that a nonsynonymous single nucleotide polymorphism in SLC29A1 (rs45458701) is responsible for the At(a-) blood type. The resulting p.Glu391Lys variation in the last extracellular loop of the equilibrative nucleoside transporter 1 (ENT1; also called SLC29a1) is known not to alter its ability to transport nucleosides and nucleoside analog drugs. Furthermore, we identified 3 individuals of European ancestry who are homozygous for a null mutation in SLC29A1 (c.589+1G>C) and thus have the Augustine-null blood type. These individuals lacking ENT1 exhibit periarticular and ectopic mineralization, which confirms an important role for ENT1/SLC29A1 in human bone homeostasis as recently suggested by the skeletal phenotype of aging Slc29a1(-/-) mice. Our results establish Augustine as a new blood group system and place SLC29A1 as a new candidate gene for idiopathic disorders characterized with ectopic calcification/mineralization.

BACKGROUND

Paclitaxel and gemcitabine (PG) combination chemotherapy is effective as a maintenance chemotherapeutic regimen in metastatic breast cancer (MBC) patients because it increases progression-free survival (PFS), which increases overall survival (OS). The primary purpose of our study was to investigate the association between genetic polymorphisms in the genes involved in PG pathways and clinical outcomes in MBC patients treated with PG chemotherapy.

METHODS

A total of 324 MBC patients were enrolled in this prospective multicenter trial of PG as the first-line chemotherapy. Eighty-five of the 324 patients from two institutes were available for analysis of single nucleotide polymorphisms (SNPs). Germline DNA was extracted from peripheral blood mononuclear cells. Thirty-eight SNPs in 15 candidate genes selected from pathways that may influence the metabolism and transport of, or sensitivity, to PG were analysed.

RESULTS

The median PFS and OS of all 324 patients were 8.7 months (95% confidence interval [CI]: 7.5-9.6 months) and 26.9 months (95% CI: 23.6-30.1 months), respectively. An SNP in SLC28A3 (rs7867504, C/T) was associated with OS (CC or CT versus TT: 37 versus 21 months, p = 0.027, hazard ratio [HR] 2.6, 95% CI: 1.1-6.3). SLC29A1 GA haplotype had a significantly shorter OS (p = 0.030, HR 3.391, 95% CI: 1.13-10.19). RRM1 (ribonucleotide reductase large subunit M1) SNP (rs9937), and haplotypes ATAA and ATGA were significantly associated with neurotoxicity.

CONCLUSIONS

Genetic polymorphisms in SLC28A3, SLC29A1 and RRM1 can influence the clinical outcome of MBC patients treated with PG chemotherapy. Further studies on the functional mechanisms relating to these germline polymorphisms in these genes are warranted.