Membrane transporters and channels (collectively the transportome) govern cellular influx and efflux of ions, nutrients, and drugs. We used oligonucleotide arrays to analyze gene expression of the transportome in 60 human cancer cell lines used by the National Cancer Institute for drug screening. Correlating gene expression with the potencies of 119 standard anticancer drugs identified known drug-transporter interactions and suggested novel ones. Folate, nucleoside, and amino acid transporters positively correlated with chemosensitivity to their respective drug substrates. We validated the positive correlation between SLC29A1 (nucleoside transporter ENT1) expression and potency of nucleoside analogues, azacytidine and inosine-glycodialdehyde. Application of an inhibitor of SLC29A1, nitrobenzylmercaptopurine ribonucleoside, significantly reduced the potency of these two drugs, indicating that SLC29A1 plays a role in cellular uptake. Three ABC efflux transporters (ABCB1, ABCC3, and ABCB5) showed significant negative correlations with multiple drugs, suggesting a mechanism of drug resistance. ABCB1 expression correlated negatively with potencies of 19 known ABCB1 substrates and with Baker's antifol and geldanamycin. Use of RNA interference reduced ABCB1 mRNA levels and concomitantly increased sensitivity to these two drugs, as expected for ABCB1 substrates. Similarly, specific silencing of ABCB5 by small interfering RNA increased sensitivity to several drugs in melanoma cells, implicating ABCB5 as a novel chemoresistance factor. Ion exchangers, ion channels, and subunits of proton and sodium pumps variably correlated with drug potency. This study identifies numerous potential drug-transporter relationships and supports a prominent role for membrane transport in determining chemosensitivity. Measurement of transporter gene expression may prove useful in predicting anticancer drug response.

Heroin addiction is a chronic complex disease with a substantial genetic contribution. This study was designed to identify gene variants associated with heroin addiction in African Americans. The emphasis was on genes involved in reward modulation, behavioral control, cognitive function, signal transduction and stress response. We have performed a case-control association analysis by screening with 1350 variants of 130 genes. The sample consisted of 202 former severe heroin addicts in methadone treatment and 167 healthy controls with no history of drug abuse. Single nucleotide polymorphism (SNP), haplotype and multi-SNP genotype pattern analyses were performed. Seventeen SNPs showed point-wise significant association with heroin addiction (nominal P< 0.01). These SNPs are from genes encoding several receptors: adrenergic (ADRA1A), arginine vasopressin (AVPR1A), cholinergic (CHRM2), dopamine (DRD1), GABA-A (GABRB3), glutamate (GRIN2A) and serotonin (HTR3A) as well as alcohol dehydrogenase (ADH7), glutamic acid decarboxylase (GAD1 and GAD2), the nucleoside transporter (SLC29A1) and diazepam-binding inhibitor (DBI). The most significant result of the analyses was obtained for the GRIN2A haplotype G-A-T (rs4587976-rs1071502-rs1366076) with protective effect (P(uncorrected) = 9.6E- 05, P(corrected) = 0.058). This study corroborates several reported associations with alcohol and drug addiction as well as other related disorders and extends the list of variants that may affect the development of heroin addiction. Further studies will be necessary to replicate these associations and to elucidate the roles of these variants in drug addiction vulnerability.

To understand the mechanism of cellular resistance to the nucleoside analogue cytarabine (1-beta-D-arabinofuranosylcytosine, AraC), two resistant derivatives of the human leukemic line CCRF-CEM were obtained by stepwise selection in different concentrations of AraC. CEM/4xAraC cells showed low AraC resistance, whereas CEM/20xAraC cells showed high resistance. Both cell lines showed similar patterns of cross-resistance to multiple cytotoxic nucleoside analogues, with the exception that CEM/20xAraC cells remained sensitive to 5-fluorouridine and 2-deoxy-5-fluorouridine. Both cell lines were sensitive to 5-fluorouracil and to a variety of natural product drugs. Although both CEM/4xAraC and CEM/20xAraC cells displayed reduced intracellular accumulation of [(3)H]AraC, only CEM/4xAraC cells showed reduced uptake of [(3)H]uridine, which was used to assess nucleoside transport activities. Genes encoding proteins known to be involved in nucleoside transport, efflux, and metabolism were analyzed for the presence of mutations in the two cell lines. In CEM/4xAraC cells, independent mutations were identified at each allele of human equilibrative nucleoside transporter 1 (hENT1; SLC29A1), one corresponding to a single-nucleotide change in exon 4, the other being a complex intronic mutation disrupting splicing of exon 13. In contrast to CEM/20xAraC cells, CEM/4xAraC cells did not bind the hENT1/SLC29A1 ligand nitrobenzylmercaptopurine ribonucleoside and lacked detectable hENT1/SLC29A1 protein. In CEM/20xAraC cells, independent intronic mutations impairing splicing of exons 2 and 3 were found at each allele of the deoxycytidine kinase gene. These studies point to at least two distinct mechanisms of AraC resistance in leukemic cells.

OBJECTIVE

To determine whether insulin reverses gestational diabetes mellitus (GDM)-reduced expression and activity of human equilibrative nucleoside transporters 1 (hENT1) in human umbilical vein endothelium cells (HUVECs).

METHODS

Primary cultured HUVECs from full-term normal (n = 44) and diet-treated GDM (n = 44) pregnancies were used. Insulin effect was assayed on hENT1 expression (protein, mRNA, SLC29A1 promoter activity) and activity (initial rates of adenosine transport) as well as endothelial nitric oxide (NO) synthase activity (serine(1177) phosphorylation, l-citrulline formation). Adenosine concentration in culture medium and umbilical vein blood (high-performance liquid chromatography) as well as insulin receptor A and B expression (quantitative PCR) were determined. Reactivity of umbilical vein rings to adenosine and insulin was assayed by wire myography. Experiments were in the absence or presence of l-N(G)-nitro-l-arginine methyl ester (l-NAME; NO synthase inhibitor) or ZM-241385 (an A(2A)-adenosine receptor antagonist).

RESULTS

Umbilical vein blood adenosine concentration was higher, and the adenosine- and insulin-induced NO/endothelium-dependent umbilical vein relaxation was lower in GDM. Cells from GDM exhibited increased insulin receptor A isoform expression in addition to the reported NO-dependent inhibition of hENT1-adenosine transport and SLC29A1 reporter repression, and increased extracellular concentration of adenosine and NO synthase activity. Insulin reversed all these parameters to values in normal pregnancies, an effect blocked by ZM-241385 and l-NAME.

CONCLUSIONS

GDM and normal pregnancy HUVEC phenotypes are differentially responsive to insulin, a phenomenon where insulin acts as protecting factor for endothelial dysfunction characteristic of this syndrome. Abnormal adenosine plasma levels, and potentially A(2A)-adenosine receptors and insulin receptor A, will play crucial roles in this phenomenon in GDM.

Human endothelial dysfunction is a common feature in many diseases of pregnancy, such as gestational diabetes (GD). Metabolic changes include abnormal synthesis of nitric oxide (NO) and abnormal membrane transport of l-arginine and adenosine in primary cultures of human umbilical vein (HUVEC, macrovascular) and placental microvillus (hPMEC, microvascular) endothelial cells. These alterations are associated with modifications in the expression and activity of endothelial (eNOS) and inducible (iNOS) NO synthases, respectively, an effect that is maintained at least up to passage 5 in culture. HUVEC and hPMEC exhibit expression and activity of the human cationic amino acid transporter 1 (hCAT-1), equilibrative nucleoside transporters 1 (hENT1) and hENT2, as well as the corresponding SLC7A1, SLC29A1 and SLC29A2 gene promoter activities. Altered gene expression results from increased NO level, protein kinase C, mitogen-activated protein kinases, and hCHOP-C/EBPα transcription factor activation. Reduced ENT-mediated adenosine transport in GD is associated with stimulation of the l-arginine/NO pathway, and mainly due to reduced expression and activity of hENT1. In addition, hENT2 activity seems able to restore the reduced adenosine transport in GD. Additionally, insulin exerts a differential modulation of endothelial cells from macrocirculation compared with microcirculation, possibly due to expression of different insulin receptor isoforms. It is suggested that a common functional characteristic leading to changes in the bioavailability of adenosine and metabolism of l-arginine is evidenced by human fetal micro and macrovascular endothelium in GD.

Systemic disposition of nucleosides and nucleoside analogs is dependent on renal handling of these compounds. There are five known, functionally characterized nucleoside transporters with varying substrate specificities for nucleosides: concentrative nucleoside transporters (CNT1-CNT3; Solute Carrier (SLC) 28A1-28A3), which mediate the intracellular flux of nucleosides, and equilibrative nucleoside transporters (ENT1-ENT2; SLC29A1-SLC29A2), which mediate bi-directional facilitated diffusion of nucleosides. All five of these transporters are expressed in the kidney. Concentrative nucleoside transporters primarily localize to the apical membrane of renal epithelial cells while equilibrative nucleoside transporters primarily localize to the basolateral membrane. These transporters work in concert to mediate reabsorptive flux of naturally occurring nucleosides and nucleoside analogs. In addition, equilibrative transporters also participate in secretory flux of some nucleoside analogs. Nucleoside transporters also serve in the targeting of nucleoside analog therapies to renal tumors. This review examines the role that these transporters play in renal disposition of nucleosides and nucleoside analogs in both systemic and kidney-specific therapies.

Thirty-nine genetic variations, including thirty novel ones, were found in the human SLC29A1 gene, which encodes equilibrative nucleoside transporter 1, from 256 Japanese cancer patients administered gemcitabine. The found novel variations included -8,166G>A, -81,10A>G, -7,947G>A, -7,789T>C, -5,595G>A, -3,803_-3,783delTCGGGGAGGTGGCAGTGGGCG, -3,548G>C, -3,414G>A, -1355T>C, -34C>G, IVS1+141G>A, IVS1+260C>T, IVS1-82C>T, 177C>G, IVS3-6C>T, 564C>T, IVS8+44T>C, IVS8+90T>C, IVS8+97T>C, IVS8+131C>T, IVS8+169G>A, 933T>C, 954C>T, IVS11-52G>C, IVS11-46G>A, 1,288G>A, 1,641C>G, 1,703_1,704delGT, 1812C>T, and 1861C>T. The frequencies were 0.051 for IVS8+169G>A, 0.012 for -7,947G>A, 0.006 for IVS1+141G>A and 1,703_1,704delGT, 0.004 for -8,166G>A, -8,110A>G, -3,548G>C, -1,355T>C, -34C>G, IVS8+44T>C, and 1,812C>T, and 0.002 for the other 19 variations. Among them, 177C>G and 1,288G>A resulted in amino acid substitutions Asp59Glu and Ala430Thr, respectively. Using the detected polymorphisms, linkage disequilibrium analysis was performed, and 28 haplotypes were identified or inferred. Our findings would provide fundamental and useful information for genotyping SLC29A1 in the Japanese and probably other Asian populations.

BACKGROUND

Different DNA aberrations processes can cause colorectal cancer (CRC). Herein, we conducted a comprehensive molecular characterization of 27 CRCs from Iranian patients.

METHODS

Array CGH was performed. The MSI phenotype and the methylation status of 15 genes was established using MSP. The CGH data was compared to two established lists of 41 and 68 cancer genes, respectively, and to CGH data from African Americans. A maximum parsimony cladogram based on global aberrations was established.

RESULTS

The number of aberrations seem to depend on the MSI status. MSI-H tumors displayed the lowest number of aberrations. MSP revealed that most markers were methylated, except RNF182 gene. P16 and MLH1 genes were primarily methylated in MSI-H tumors. Seven markers with moderate to high frequency of methylation (SYNE1, MMP2, CD109, EVL, RET, LGR and PTPRD) had very low levels of chromosomal aberrations. All chromosomes were targeted by aberrations with deletions more frequent than amplifications. The most amplified markers were CD248, ERCC6, ERGIC3, GNAS, MMP2, NF1, P2RX7, SFRS6, SLC29A1 and TBX22. Most deletions were noted for ADAM29, CHL1, CSMD3, FBXW7, GALNS, MMP2, NF1, PRKD1, SMAD4 and TP53. Aberrations targeting chromosome X were primarily amplifications in male patients and deletions in female patients. A finding similar to what we reported for African American CRC patients.

CONCLUSIONS

This first comprehensive analysis of CRC Iranian tumors reveals a high MSI rate. The MSI tumors displayed the lowest level of chromosomal aberrations but high frequency of methylation. The MSI-L were predominantly targeted with chromosomal instability in a way similar to the MSS tumors. The global chromosomal aberration profiles showed many similarities with other populations but also differences that might allow a better understanding of CRC's clinico-pathological specifics in this population.