Citations
All
Search in:AllTitleAbstractAuthor name
Publications
(230)
Patents
Grants
Pathways
Clinical trials
Publication
Journal: Drug Metabolism and Pharmacokinetics
June/6/2014
Abstract
Ribavirin (RBV), a guanosine analog for treatment of hepatitis C, is a substrate of a nucleoside transporter, solute carrier family 29 member 1 (SLC29A1). To clarify the impact of SLC29A1 on the pharmacokinetics of RBV, an open-label, crossover study of single-dose RBV (200 mg, p.o.) with and without coadministration of dipyridamole (DP), an inhibitor of SLC29A1, was performed. Plasma and erythrocyte concentrations of RBV in the control phase and DP phase (25 mg, 3 times daily for 4 days) were compared in 10 healthy volunteers. SLC29A1 mRNA expression in peripheral blood mononuclear cells was also determined. In the DP phase, area under the concentration-time curves (AUC) of RBV in plasma and erythrocytes showed reductions of 23% and 17%, respectively (p < 0.05), with increases in apparent oral clearance of 18% and 25%, respectively (p < 0.05). The reduction rate of the AUC of erythrocyte RBV in the DP phase was associated with SLC29A1 mRNA expression: higher mRNA expression showed greater AUC reduction. The elimination half-life of both plasma and erythrocyte RBV did not differ between the 2 phases. These results suggest that RBV/DP coadministration reduces the concentration of RBV in blood by inhibiting an important role of SLC29A1 in gastrointestinal absorption of RBV.
Publication
Journal: Genetics and Molecular Research
February/28/2017
Abstract
Human equilibrative nucleoside transporters (hENT) 1 and 2, encoded by SLC29A1 and SLC29A2, permit the bidirectional passage of nucleoside analogues into cells and may correlate with clinical responses to chemotherapy in patients with colorectal cancer (CRC). The purpose of this study was to evaluate the expression profiles of SLC29A1 and SLC29A2 in human cancer cell lines. Using quantitative real-time polymerase chain reaction, we comprehensively profiled the transcription levels of SLC29A1 and SLC29A2 in 16 colon cancer cell lines. We validated the ubiquitous and heterogeneous distribution of SLC29A1 and SLC29A2 in human colon cancer cell lines and demonstrated that SLC29A1 was highly expressed in 25% of metastatic cell lines (Colo201 and Colo205) and 62.5% of primary cell lines (Caco2, Colo320, HCT116, RKO, and SW48). For the first time, we showed that both SLC29A1 and SLC29A2 were expressed at lower levels in colon cancer cell lines originating from metastatic sites than from primary sites. These findings indicate that most patients with metastatic CRC (mCRC) may have low hENT1 expression, and treatment with nucleoside analogues may be inefficient. However, some patients still show high hENT1 expression and have a high probability of benefiting from these drugs. Therefore, evaluating transporter expression profiles and different drug responses between primary and metastatic tumors in patients with mCRC is important. Further assessment of the association between hENTs and drug-based treatment of mCRC is required to elucidate the mechanisms of chemotherapy resistance.
Publication
Journal: Pharmacology
June/13/2016
Abstract
Chronic hepatitis C is one of the most important causes of liver disease, leading to cirrhosis, hepatic decompensation and hepatocellular carcinoma. Recently some important advances in therapy have been achieved with the introduction of first wave, first generation direct acting antiviral agents (DAAs) such as boceprevir (BOC), in combination with pegylated interferon (Peg-IFN) and ribavirin (RBV). The superior rate of sustained virological response with this treatment is accompanied by an elevated frequency of anaemia. Several studies have evidenced the importance of single nucleotide polymorphisms (SNPs) in inosine triphosphatase (ITPA) and solute carrier family 29, member 1 (SLC29A1) genes in the development of this adverse event. Here, we investigated haemoglobin levels and the best-known functional SNPs in ITPA and SLC29A1 genes in 22 patients treated with triple therapy with BOC/Peg-IFN/RBV. The identification of ITPA protective and SLC29A1 risk genotypes still appears to be a current methodology in RBV dosing during hepatitis C virus therapy with DAAs.
Publication
Journal: Journal of Translational Medicine
November/25/2017
Abstract
BACKGROUND
Gene polymorphisms at microRNA-binding sites (poly-miRTS) may affect gene transcription and expression through miRNA regulation, which is associated with cancer susceptibility, sensitivity to chemotherapy and prognosis. This study investigated the association between poly-miRTS of Ara-C/anthracycline metabolic pathways genes and the outcome of acute myeloid leukemia (AML) in Chinese patients after Ara-C-based chemotherapy.
METHODS
A total of 17 poly-miRTS were selected from the SNPinfo Web Server and genotyped in 206 Chinese Han non-FAB-M3 AML patients using the SEQUENOM Mass-ARRAY system.
RESULTS
Among these 17 poly-miRTS, five Ara-C metabolic gene single nucleotide polymorphisms (SNPs, NT5C2 rs10786736 and rs8139, SLC29A1 rs3734703, DCTD rs7278, and RRM1 rs1042919) were identified to significantly associate with complete AML remission and/or overall and relapse-free survival (OS and RFS, respectively), and four anthracycline-metabolic gene SNPs (ABCC1 rs3743527, rs212091, and rs212090 and CBR1 rs9024) were significantly associated with chemotherapy-related toxicities. Moreover, SLC29A1 rs3734703 was shown to associate with both chemotherapy response and survival (adjusted OR 2.561 in the overdominant model; adjusted HR 2.876 for OS and 2.357 for RFS in the dominant model).
CONCLUSIONS
The data from the current study demonstrated that the poly-miRTS of Ara-C/anthracyclines metabolic genes predicted the sensitivity and side effects of AML to Ara-C-based chemotherapy and patient survival. Further study will confirm them as biomarkers for AML patients after Ara-C-based chemotherapy.
Publication
Journal: Immunohematology
July/19/2017
Abstract
The high-prevalence antigen, Ata, was first identified in 1967, but it was not until 2015 that Ata became AUG1 of a new blood group system, Augustine (AUG). The new system was established after the identification of the gene encoding Ata and the recognition of a null phenotype (AUG:–1,–2) in an At(a–) patient with an antibody (anti-AUG2) reactive with At(a–) red blood cells. The At(a–) phenotype is very rare and, with the exception of the one family with the null phenotype, has only been found in individuals of African origin. Anti-Ata has been implicated in immediate and delayed hemolytic transfusion reactions, but not in severe hemolytic disease of the fetus and newborn. The Augustine gene is SLC29A1, which encodes the equilibrative nucleoside transporter ENT1. At(a–) (AUG:–1,2) results from homozygosity for c.1171G>A, encoding Glu391Lys, whereas the AUGnull (AUG:–1,–2) phenotype results from homozygosity for a splice site mutation, c.589+1G>C, in the only family where it has been found. Absence of ENT1 in that family may be associated with pseudogout and abnormal bone calcification.
Publication
Journal: Journal of the Science of Food and Agriculture
December/21/2020
Abstract
Background: As an enzymatic product of yeast, yeast-based nucleotide (YN) is rich in nucleotides. To test the effects of maternal dietary supplementation with YN during late pregnancy on placental nutrient transport, and nutrient metabolism of neonatal piglets, sixty-four pregnant sows (day 85 ± 3) were assigned into two groups:(1) control (CON) and (2) treatment (YN, 4 g kg-1 ). Blood, placenta, and liver samples of neonates during delivery were collected.
Results: Results showed that maternal YN supplementation decreased stillbirth rate and intra-uterine growth restriction rate (P<0.05). In addition, maternal YN supplementation increased total serum protein, albumin, and total cholesterol (P<0.05). Furthermore, in neonatal piglets in the YN group, both serum amino acids and nucleotides profile were affected, as well as liver amino acids, and fatty acids profiles were regulated (P<0.05). Moreover, maternal YN supplementation increased liver mRNA expression of SLC28A3, SLC29A1, SLC29A2, PC, PCK1, FBP1, SREBP1c, HSL, and CYP7a1 of neonatal piglets (P <0.05). Meanwhile, a decrease in placental gene expression of EAAT2, EAAT3, LAT1, and PAT1, and lower protein expression of PPARγ, AKT, phosphorylated-AKT, phosphorylated-mTOR and Raptor were observed in the YN group (P<0.05).
Conclusion: Together, these results indicated that maternal YN supplementation regulated placental nutrients transport by regulating the mTORC1-PPARs pathway, and affected liver metabolism of nucleotides, amino acids, and fatty acids in neonatal piglets, thereby improving the reproductive performance of sow to a certain extent. This article is protected by copyright. All rights reserved.
Keywords: Nucleotides; amino acids; fatty acids; neonatal piglets; placenta.
Publication
Journal: Pharmaceuticals
February/20/2019
Abstract
The benefits of PET imaging of tumor hypoxia in patient management has been demonstrated in many examples and with various tracers over the last years. Although, the optimal hypoxia imaging agent has yet to be found, 2-nitroimidazole (azomycin) sugar derivatives-mimicking nucleosides-have proven their potential with [18F]FAZA ([18F]fluoro-azomycin-α-arabinoside) as a prominent representative in clinical use. Still, for all of these tracers, cellular uptake by passive diffusion is postulated with the disadvantage of slow kinetics and low tumor-to-background ratios. We recently evaluated [18F]fluoro-azomycin-β-deoxyriboside (β-[18F]FAZDR), with a structure more similar to nucleosides than [18F]FAZA and possible interaction with nucleoside transporters. For a deeper insight, we comparatively studied the interaction of FAZA, β-FAZA, α-FAZDR and β-FAZDR with nucleoside transporters (SLC29A1/2 and SLC28A1/2/3) in vitro, showing variable interactions of the compounds. The highest interactions being for β-FAZDR (IC50 124 ± 33 µM for SLC28A3), but also for FAZA with the non-nucleosidic α-configuration, the interactions were remarkable (290 ± 44 µM {SLC28A1}; 640 ± 10 µM {SLC28A2}). An improved synthesis was developed for β-FAZA. For a PET study in tumor-bearing mice, α-[18F]FAZDR was synthesized (radiochemical yield: 15.9 ± 9.0% (n = 3), max. 10.3 GBq, molar activity > 50 GBq/µmol) and compared to β-[18F]FAZDR and [18F]FMISO, the hypoxia imaging gold standard. We observed highest tumor-to-muscle ratios (TMR) for β-[18F]FAZDR already at 1 h p.i. (2.52 ± 0.94, n = 4) in comparison to [18F]FMISO (1.37 ± 0.11, n = 5) and α-[18F]FAZDR (1.93 ± 0.39, n = 4), with possible mediation by the involvement of nucleoside transporters. After 3 h p.i., TMR were not significantly different for all 3 tracers (2.5⁻3.0). Highest clearance from tumor tissue was observed for β-[18F]FAZDR (56.6 ± 6.8%, 2 h p.i.), followed by α-[18F]FAZDR (34.2 ± 7.5%) and [18F]FMISO (11.8 ± 6.5%). In conclusion, both isomers of [18F]FAZDR showed their potential as PET hypoxia tracers. Differences in uptake behavior may be attributed to a potential variable involvement of transport mechanisms.
Publication
Journal: Journal of Antimicrobial Chemotherapy
November/11/2015
Abstract
OBJECTIVE
The equilibrative nucleoside transporter 1 (ENT1) is the main protein involved in ribavirin cellular uptake. Polymorphisms at the SLC29A1 gene, encoding ENT1, may influence ribavirin-associated anaemia, which is observed at a higher incidence with telaprevir in combination with pegylated-IFNα and ribavirin than with pegylated-IFNα and ribavirin alone. In this study, we investigated the role of the rs760370 SLC29A1 variant in ribavirin-induced anaemia in chronic hepatitis C patients treated with telaprevir-based triple therapy.
METHODS
Forty patients infected with hepatitis C virus (HCV) genotype 1 and starting anti-HCV therapy with telaprevir in combination with pegylated-IFN/ribavirin were prospectively evaluated for SNPs at the SLC29A1 gene and inosine triphosphatase (ITPA) genes using a real-time PCR system.
RESULTS
40% of patients developed severe anaemia with a haemoglobin (Hb) decline ≥ 5 g/dL from the pretreatment value. The SLC29A1 rs760370 GG genotype was associated with the severity of Hb decrease as expressed by the median (IQR) Hb nadir change from baseline [-5.4 (-5.6; -5.0) g/dL in GG versus -4.2 (-5.1; -3.4) in AA/AG genotype; P=0.05] and by the Hb decrease ≥ 5 g/dL by week 12 (77.8% of GG carriers versus 24% of AA/AG; P<0.01). In multivariate analysis, older age (P=0.03), lower baseline Hb concentration (P=0.02) and SLC29A1 rs760370 GG (P=0.02) were associated with the development of severe anaemia during treatment, whereas no association was found with ITPA SNPs in our population receiving telaprevir-based therapy.
CONCLUSIONS
In patients with chronic hepatitis C receiving telaprevir-based therapy, SNP rs760370A>G at the SLC29A1 gene influences the severity of ribavirin-induced anaemia, possibly mirroring the erythrocyte uptake of ribavirin.
Publication
Journal: Placenta
November/13/2018
Abstract
BACKGROUND
The objectives of this study were to determine how HCV infection affects placental drug transporters, and to determine the role of drug transporters on the cellular accumulation of direct-acting antiviral drugs in human trophoblasts.
METHODS
Eighty-four ABC and SLC transporter genes were first screened in normal and HCV infected pregnant women using PCR profiler array. The changes in expression were confirmed by qPCR and Western blot. The impact of selected drug transporters on the cellular accumulation of radiolabeled antiviral drugs sofosbuvir, entecavir, and tenofovir was measured in primary human trophoblasts (PHT) and BeWo b30 cells in the presence or absence of transporter-specific inhibitors. PHT were then treated with CL097, ssRNA40, and imquimod to determine the impact of Toll-like receptor (TLR) 7/8 activation on drug transporter expression.
RESULTS
The expression of the ABC efflux transporters ABCB1/P-gp and ABCG2/BCRP was increased in placenta of women with HCV, while the nucleoside transporters SLC29A1/ENT1 and SLC29A2/ENT2 remained unchanged. The accumulation of sofosbuvir and tenofovir was unaffected by inhibition of these transporters in trophoblast cells. Entecavir accumulation was decreased by the inhibition of ENT2. P-gp and BCRP inhibition enhanced entecavir accumulation in BeWo b30, but not PHT. Overall, there was little effect of TLR7/8 activation on these drug transporters, and the accumulation of entecavir in PHT.
CONCLUSIONS
The data suggest that expression of placental drug transporters and selection of antiviral drug may impact fetal drug exposure in pregnancies complicated by HCV infections.
Related with
Publication
Journal: Pharmacogenetics and Genomics
March/19/2019
Abstract
One of the standard of care regimens for advanced pancreatic cancer is gemcitabine-based chemotherapy. The efficacy of gemcitabine is limited by dose-limiting hematologic toxicities especially neutropenia. Uncovering the variability of these toxicities attributed to germline DNA variation is of great importance.CALGB 80303 was a randomized study in advanced pancreatic cancer patients treated with gemcitabine with or without bevacizumab. The study protocol included genotyping of genes of gemcitabine disposition (CDA, DCTD, SLC29A1, SLC28A1, and SLC29A2), as well as a genome-wide analysis. The clinical phenotype was time to early high-grade neutropenia event accounting for progression or death or other treatment-terminating adverse events as competing for informative events. The inference was carried out on the basis of the association between genotype and cause-specific hazard of a neutropenic event.The primary analyses were carried out on the basis of 294 genetically estimated European pancreatic cancer patients. For CDA rs2072671 (A>C), AC and CC patients had a lower risk of neutropenia than AA patients (P=0.01, hazard ratio: 0.61, 95% confidence interval: 0.41-0.89). For SLC28A1 rs3825876 (G>A), AA patients have a higher risk of neutropenia than GA and GG patients (P=0.02, hazard ratio: 1.51, 95% confidence interval: 1.06-2.16). CDA rs2072671 was associated with increased mRNA expression in whole blood in three studies (P=2.7e-14, 6.61e-62, and 9.70e-65). In the genome-wide analysis, variants in TGFB2 were among the top hits (lowest P=1.62e-06) but had no effect in luciferase assays.This is the first genetic analysis of gemcitabine-induced neutropenia using a competing risk model in a prospective randomized clinical study has proposed a potentially novel mechanism of the protective effect of the CDA rs2072671 variant. Further confirmation is needed.
Publication
Journal: PLoS ONE
December/6/2018
Abstract
Slc29a1 encodes for equilibrative nucleoside transporter subtype 1 (ENT1), the primary mechanism of adenosine transfer across cell membranes. Previous studies showed that tissues isolated from Slc29a1-null mice are relatively resistant to injury caused by vascular ischemia-reperfusion. To determine if there are similar changes in the microvasculature, and investigate underlying mechanism, we examined aortas isolated from wildtype and Slc29a1-null mice. Aorta macrostructure and gene expression were examined histologically and by qPCR, respectively. Wire myography was used to assess the contractile properties of isolated thoracic aortic rings and their response to adenosine under both normoxic and hypoxic conditions. In vivo haemodynamic parameters were assessed using the tail-cuff method. Slc29a1-null mice had significantly (P<0.05) increased plasma adenosine (2.75-fold) and lower blood pressure (~15% ↓) than wild-type mice. Aortas from Slc29a1-null mice were stiffer with a smaller circumference (11% ↓), and had an enhanced contractile response to KCl and receptor-mediated stimuli. Blockade of ENT1 with nitrobenzylthioinosine significantly enhanced (by ~3.5-fold) the response of aorta from wild-type mice to phenylephrine, but had minimal effect on aortas from Slc29a1-null mice. Adenosine enhanced phenylephrine-mediated constriction in the wild-type tissue under both normoxic (11.7-fold) and hypoxic (3.6-fold) conditions, but had no effect on the Slc29a1-null aortic aorta. In conclusion, aortas from Slc29a1-null mice respond to hypoxic insult in a manner comparable to wild-type tissues that have been pharmacologically preconditioned with adenosine. These data also support a role for ENT1 in the regulation of the protective effects of adenosine on contractile function in elastic conduit arteries such as thoracic aorta.
Publication
Journal: AIDS
July/27/2016
Abstract
Ribavirin (RBV) induced anemia may be influenced by host genetic factors affecting RBV transport solute carrier (SLC) or metabolism inosine triphosphatase (ITPA), as already reported. We investigated the influence of single nucleotide polymorphisms (SNPs) on SLC genes on anemia, RBV trough concentration (Ctrough) and response in HIV-hepatitis C virus coinfected patients receiving triple therapy with boceprevir or telaprevir.
Patients from the ANRS HC26/HC27 studies were genotyped for SLC28A3 SNPs (rs10868138 and rs56350726) and SL29A1 SNPs (rs760370). Hemoglobin (Hb) decline was collected at baseline day 0 (D0), week 4 (W4) and week 8 (W8), and RBV Ctrough was measured at W4 and W8 by HPLC. A multivariate analysis including SLC SNPs, estimated glomerular filtration rate (eGFR), ITPA deficiency and RBV Ctrough was performed to determine predictive factors of anemia and response.
SLC genotyping was performed in 130 patients. Neither SLC28A3 nor SLC29A1 SNPs were associated with Hb decline both at W4 and W8. No association was found between SLC polymorphisms and RBV Ctrough. Independent predictive factors of Hb decline at W4 were D0 Hb, ITPA deficiency and W4 RBV Ctrough in the multivariate analysis (P < 0.05). Only D0 Hb, W4 RBV Ctrough and eGFRD0-W8 were predictive of anemia at W8 (P < 0.05). Response was not influenced by SLC SNPs.
eGFR, but not SLC polymorphisms, influences anemia in HIV-hepatitis C virus coinfected patients receiving boceprevir-based or telaprevir-based therapy. RBV is still a cornerstone of hepatitis C treatment, thus renal function and RBV Ctrough should be monitored in patients receiving RBV regimen combined with first-generation direct-acting antiviral agent.
Publication
Journal: Drug Metabolism and Disposition
November/27/2018
Abstract
Abacavir is a preferred antiretroviral drug for preventing mother-to-child human immunodeficiency virus transmission; however, mechanisms of its placental transfer have not been satisfactorily described to date. Because abacavir is a nucleoside-derived drug, we hypothesized that the nucleoside transporters, equilibrative nucleoside transporters (ENTs, SLC29A) and/or Na+-dependent concentrative nucleoside transporters (CNTs, SLC28A), may play a role in its passage across the placenta. To test this hypothesis, we performed uptake experiments using the choriocarcinoma-derived BeWo cell line, human fresh villous fragments, and microvillous plasma membrane (MVM) vesicles. Using endogenous substrates of nucleoside transporters, [3H]-adenosine (ENTs, CNT2, and CNT3) and [3H]-thymidine (ENTs, CNT1, and CNT3), we showed significant activity of ENT1 and CNT2 in BeWo cells, whereas experiments in the villous fragments and MVM vesicles, representing a model of the apical membrane of a syncytiotrophoblast, revealed only ENT1 activity. When testing [3H]-abacavir uptakes, we showed that of the nucleoside transporters, ENT1 plays the dominant role in abacavir uptake into placental tissues, whereas contribution of Na+-dependent transport, most likely mediated by CNTs, was observed only in BeWo cells. Subsequent experiments with dually perfused rat term placentas showed that Ent1 contributes significantly to overall [3H]-abacavir placental transport. Finally, we quantified the expression of SLC29A in first- and third-trimester placentas, revealing that SLC29A1 is the dominant isoform. Neither SLC29A1 nor SLC29A2 expression changed over the course of placental development, but there was considerable interindividual variability in their expression. Therefore, drug-drug interactions and the effect of interindividual variability in placental ENT1 expression on abacavir disposition into fetal circulation should be further investigated to guarantee safe and effective abacavir-based combination therapies in pregnancy.
Related with
Publication
Journal: Molecular Pharmaceutics
May/18/2021
Abstract
Our goal was to measure the absolute differential abundance of key drug transporters in human epileptogenic brain tissue and to compare them between patients and at various distances from the epileptogenic zone within the same patient. Transporter protein abundance was quantified in brain tissue homogenates from patients who underwent epilepsy surgery, using targeted proteomics, and correlations with clinical and tissue characteristics were assessed. Fourteen brain samples (including four epileptogenic hippocampal samples) were collected from nine patients. Among the quantifiable drug transporters, the abundance (median, range) ranked: breast cancer resistance protein (ABCG2/BCRP; 0.55, 0.01-3.26 pmol/g tissue) > P-glycoprotein (ABCB1/MDR1; 0.30, 0.02-1.15 pmol/g tissue) > equilibrative nucleoside transporter 1 (SLC29A1/ENT1; 0.06, 0.001-0.35 pmol/g tissue). The ABCB1/ABCG2 ratio (mean 0.27, range 0.08-0.47) was comparable with literature values from nonepileptogenic brain tissue (mean 0.5-0.8). Transporter abundance was lower in the hippocampi than in the less epileptogenic neocortex of the same patients. ABCG2/BCRP and ABCB1/MDR1 expression strongly correlated with that of glucose transporter 1 (SLC2A1/GLUT1) (r = 0.97, p < 0.001; r = 0.90, p < 0.01, respectively). Low transporter abundance was found in patients with overt vascular pathology, whereas the highest abundance was seen in a sample with normally appearing blood vessels. In conclusion, drug transporter abundance highly varies across patients and between epileptogenic and less epileptogenic brain tissue of the same patient. The strong correlation in abundance of ABCB1/MDR1, ABCG2/BCRP, and SLC2A1/GLUT1 suggests variation in the content of the functional vasculature within the tissue samples. The epileptogenic tissue can be depleted of key drug transport mechanisms, warranting consideration when selecting treatments for patients with drug-resistant epilepsy.
Keywords: P-glycoprotein; antiepileptic drugs; antiseizure medications; breast cancer resistance protein; epilepsy; targeted proteomics.
Publication
Journal: Neurochemical Research
June/20/2021
Abstract
MicroRNA-33-3p (miR-33-3p) has been widely investigated for its roles in lipid metabolism and mitochondrial function; however, there are few studies on miR-33-3p in the context of neurological diseases. In this study, we investigated the functional role of miR-33-3p in rat pheochromocytoma PC12 cells. A miR-33-3p mimic was transduced into PC12 cells, and its effects on proliferation, apoptosis, and differentiation were studied using the MTS assay, EdU labeling, flow cytometry, qRT-PCR, western blot, ELISA, and immunofluorescence. We found that miR-33-3p significantly suppressed PC12 cell proliferation, but had no effect on apoptosis. Furthermore, miR-33-3p promoted the differentiation of PC12 cells into Tuj1-positive and choline acetyltransferase-positive neuron-like cells. Mechanistically, miR-33-3p repressed the expression of Slc29a1 in PC12 cells. Importantly, knocking down Slc29a1 in PC12 cells inhibited proliferation and induced differentiation into neuron-like cells. In conclusion, this study showed that miR-33-3p regulated Slc29a1, which in turn controlled the proliferation and differentiation of PC12 cells. Thus, we hypothesize that the miR-33-3p/Slc29a1 axis could be a promising therapeutic target for recovering neurons and the cholinergic nervous system.
Keywords: Differentiation; Pheochromocytoma cells; Proliferation; Slc29a1; miR-33-3p.
Publication
Journal: AIDS
June/26/2021
Abstract
Objective: Although antiretroviral therapy (ART) during pregnancy is effective in limiting vertical HIV transmission, adverse outcomes persist amongst uninfected children exposed to antiretroviral drugs in utero. Membrane-associated drug transporters, metabolic enzymes and tight junction proteins play important roles in adult antiretroviral drug disposition and toxicity, however, the fetal expression of these proteins in the context of ART, and their impact on in utero antiretroviral drug distribution remain poorly understood. This study aimed to characterize the role of these proteins in modulating in utero antiretroviral drug exposure.
Methods: Pregnant mice were exposed to an ART regimen consisting of lamivudine, abacavir, atazanavir and ritonavir, at clinically relevant doses. Fetal brain, liver, placenta amniotic fluid and maternal plasma were collected on gestational day 18.5 and concentration of antiretroviral drugs in fetal tissues was measured by LC/MS/MS, while transporter expression was assessed by qPCR.
Results: Abacavir and lamivudine were detected in fetal brain and amniotic fluid, while atazanavir and ritonavir were detected in amniotic fluid only. Robust mRNA expression of key transporters was observed in adult and fetal tissues, and sex differences were identified in the expression of Abcc1 and Slc29a1 in the placenta. Antiretroviral drug exposure was associated with a reduction in relative placental Abcg2, Abcc1 and Slc29a1 expression.
Conclusions: These findings identify a novel effect of fetal sex and antiretroviral drug treatment on the expression of placental transporters in a mouse model, and characterize the penetration of lamivudine and abacavir into fetal brain, uncovering a potential role of transporters in modulating fetal exposure to antiretroviral drugs.
Publication
Journal: Cancer Chemotherapy and Pharmacology
July/30/2021
Abstract
Purpose: Fluoropyrimidines are one of the most used drug class to treat cancer patients, although they show high levels of associated toxicity. This study analyzed 33 polymorphisms in 17 pharmacogenes involved with the pharmacogenomics of fluoropyrimidines, in gastrointestinal cancer patients undergoing fluoropyrimidine-based treatment in the Brazilian Amazon.
Methods: The study population was composed of 216 patients, 92 of whom have an anatomopathological diagnosis of gastric cancer and 124 of colorectal cancer. The single nucleotide polymorphisms (SNP) were genotyped by allelic discrimination using the TaqMan OpenArray Genotyping technology, with a panel of 32 customized assays, run in a QuantStudio ™ 12K Flex Real-Time PCR System (Applied Biosystems, Life Technologies, Carlsbad USA). Ancestry analysis was performed using 61 autosomal ancestry informative markers (AIMs).
Results: The study population show mean values of 48.1% European, 31.1% Amerindian, and 20.8% African ancestries. A significant risk association for general and severe toxicity was found in the rs4451422 of FPGS (p = 0.001; OR 3.40; CI 95% 1.65-7.00 and p = 0.006; OR 4.63; CI 95% 1.56-13.72, respectively) and the rs9524885 of ABCC4 (p = 0.023; OR 2.74; CI 95% 1.14-6.65 and p = 0.024; OR 5.36; IC 95% 1.24-23.11, respectively) genes. The rs760370 in the SLC29A1 gene (p = 0.009; OR 6.71; CI 95% 1.16-8.21) and the rs1801133 in the MTHFR toxicity (p = 0.023; OR 3.09; CI 95% 1.16-8.21) gene also demonstrated to be significant, although only for severe toxicity. The results found in this study did not have statistics analysis correction.
Conclusion: Four polymorphisms of the ABCC4, FPGS, SLC29A1, and MTHFR genes are likely to be potential predictive biomarkers for precision medicine in fluoropyrimidine-based treatments in the population of the Brazilian Amazon, which is constituted by a unique genetic background.
Keywords: ABCC4; FPGS; Fluoropyrimidine; MTHFR; Pharmacogenomics; SLC29A1.
Publication
Journal: Genetical Research
October/24/2021
Abstract
Primary aldosteronism is the most common form of secondary hypertension, and aldosteronoma makes up a significant proportion of primary aldosteronism cases. Aldosteronoma is also called aldosterone-producing adenoma (APA). Although there have been many studies about APA, the pathogenesis of this disease is not yet fully understood. In this study, we aimed to find out the difference of gene expression patterns between APA and nonfunctional adrenocortical adenoma (NFAA) using a weighted gene coexpression network (WGCNA) and differentially expressed gene (DEG) analysis; only the genes that meet the corresponding standards of both methods were defined as real hub genes and then used for further analysis. Twenty-nine real hub genes were found out, most of which were enriched in the phospholipid metabolic process. WISP2, S100A10, SSTR5-AS1, SLC29A1, APOC1, and SLITRK4 are six real hub genes with the same gene expression pattern between the combined and validation datasets, three of which indirectly or directly participate in lipid metabolism including WISP2, S100A10, and APOC1. According to the gene expression pattern of DEGs, we speculated five candidate drugs with potential therapeutic value for APA, one of which is cycloheximide, an inhibitor for phospholipid biosynthesis. All the evidence suggests that phospholipid metabolism may be an important pathophysiological mechanism for APA. Our study provides a new perspective regarding the pathophysiological mechanism of APA and offers some small molecules that may possibly be effective drugs against APA.
Publication
Journal: Clinical and Experimental Optometry
January/20/2022
Abstract
The cause of multiple myeloma (MM) remains largely unknown. Several pieces of evidence support the involvement of genetic and multiple environmental factors (i.e., chemical agents) in MM onset. The inter-individual variability in the bioactivation, detoxification, and clearance of chemical carcinogens such as asbestos, benzene, and pesticides might increase the MM risk. This inter-individual variability can be explained by the presence of polymorphic variants in absorption, distribution, metabolism, and excretion (ADME) genes. Despite the high relevance of this issue, few studies have focused on the inter-individual variability in ADME genes in MM risk. To identify new MM susceptibility loci, we performed an extended candidate gene approach by comparing high-throughput genotyping data of 1936 markers in 231 ADME genes on 64 MM patients and 59 controls from the CEU population. Differences in genotype and allele frequencies were validated using an internal control group of 35 non-cancer samples from the same geographic area as the patient group. We detected an association between MM risk and ADH1B rs1229984 (OR = 3.78; 95% CI, 1.18-12.13; p = 0.0282), PPARD rs6937483 (OR = 3.27; 95% CI, 1.01-10.56; p = 0.0479), SLC28A1 rs8187737 (OR = 11.33; 95% CI, 1.43-89.59; p = 0.005), SLC28A2 rs1060896 (OR = 6.58; 95% CI, 1.42-30.43; p = 0.0072), SLC29A1 rs8187630 (OR = 3.27; 95% CI, 1.01-10.56; p = 0.0479), and ALDH3A2 rs72547554 (OR = 2.46; 95% CI, 0.64-9.40; p = 0.0293). The prognostic value of these genes in MM was investigated in two public datasets showing that shorter overall survival was associated with low expression of ADH1B and SLC28A1. In conclusion, our proof-of-concept findings provide novel insights into the genetic bases of MM susceptibility.
Keywords: ADME; DMET Plus; SNP; hematological malignancies; multiple myeloma; risk alleles; single nucleotide polymorphism.
Results with error correction
Publication
Journal: Cancer Research
August/5/2004
Abstract
Membrane transporters and channels (collectively the transportome) govern cellular influx and efflux of ions, nutrients, and drugs. We used oligonucleotide arrays to analyze gene expression of the transportome in 60 human cancer cell lines used by the National Cancer Institute for drug screening. Correlating gene expression with the potencies of 119 standard anticancer drugs identified known drug-transporter interactions and suggested novel ones. Folate, nucleoside, and amino acid transporters positively correlated with chemosensitivity to their respective drug substrates. We validated the positive correlation between SLC29A1 (nucleoside transporter ENT1) expression and potency of nucleoside analogues, azacytidine and inosine-glycodialdehyde. Application of an inhibitor of SLC29A1, nitrobenzylmercaptopurine ribonucleoside, significantly reduced the potency of these two drugs, indicating that SLC29A1 plays a role in cellular uptake. Three ABC efflux transporters (ABCB1, ABCC3, and ABCB5) showed significant negative correlations with multiple drugs, suggesting a mechanism of drug resistance. ABCB1 expression correlated negatively with potencies of 19 known ABCB1 substrates and with Baker's antifol and geldanamycin. Use of RNA interference reduced ABCB1 mRNA levels and concomitantly increased sensitivity to these two drugs, as expected for ABCB1 substrates. Similarly, specific silencing of ABCB5 by small interfering RNA increased sensitivity to several drugs in melanoma cells, implicating ABCB5 as a novel chemoresistance factor. Ion exchangers, ion channels, and subunits of proton and sodium pumps variably correlated with drug potency. This study identifies numerous potential drug-transporter relationships and supports a prominent role for membrane transport in determining chemosensitivity. Measurement of transporter gene expression may prove useful in predicting anticancer drug response.
Publication
Journal: Genes, Brain and Behavior
November/9/2009
Abstract
Heroin addiction is a chronic complex disease with a substantial genetic contribution. This study was designed to identify gene variants associated with heroin addiction in African Americans. The emphasis was on genes involved in reward modulation, behavioral control, cognitive function, signal transduction and stress response. We have performed a case-control association analysis by screening with 1350 variants of 130 genes. The sample consisted of 202 former severe heroin addicts in methadone treatment and 167 healthy controls with no history of drug abuse. Single nucleotide polymorphism (SNP), haplotype and multi-SNP genotype pattern analyses were performed. Seventeen SNPs showed point-wise significant association with heroin addiction (nominal P< 0.01). These SNPs are from genes encoding several receptors: adrenergic (ADRA1A), arginine vasopressin (AVPR1A), cholinergic (CHRM2), dopamine (DRD1), GABA-A (GABRB3), glutamate (GRIN2A) and serotonin (HTR3A) as well as alcohol dehydrogenase (ADH7), glutamic acid decarboxylase (GAD1 and GAD2), the nucleoside transporter (SLC29A1) and diazepam-binding inhibitor (DBI). The most significant result of the analyses was obtained for the GRIN2A haplotype G-A-T (rs4587976-rs1071502-rs1366076) with protective effect (P(uncorrected) = 9.6E- 05, P(corrected) = 0.058). This study corroborates several reported associations with alcohol and drug addiction as well as other related disorders and extends the list of variants that may affect the development of heroin addiction. Further studies will be necessary to replicate these associations and to elucidate the roles of these variants in drug addiction vulnerability.
Pulse
Views:
2
Posts:
No posts
Rating:
Not rated
Publication
Journal: Cancer Research
April/24/2008
Abstract
To understand the mechanism of cellular resistance to the nucleoside analogue cytarabine (1-beta-D-arabinofuranosylcytosine, AraC), two resistant derivatives of the human leukemic line CCRF-CEM were obtained by stepwise selection in different concentrations of AraC. CEM/4xAraC cells showed low AraC resistance, whereas CEM/20xAraC cells showed high resistance. Both cell lines showed similar patterns of cross-resistance to multiple cytotoxic nucleoside analogues, with the exception that CEM/20xAraC cells remained sensitive to 5-fluorouridine and 2-deoxy-5-fluorouridine. Both cell lines were sensitive to 5-fluorouracil and to a variety of natural product drugs. Although both CEM/4xAraC and CEM/20xAraC cells displayed reduced intracellular accumulation of [(3)H]AraC, only CEM/4xAraC cells showed reduced uptake of [(3)H]uridine, which was used to assess nucleoside transport activities. Genes encoding proteins known to be involved in nucleoside transport, efflux, and metabolism were analyzed for the presence of mutations in the two cell lines. In CEM/4xAraC cells, independent mutations were identified at each allele of human equilibrative nucleoside transporter 1 (hENT1; SLC29A1), one corresponding to a single-nucleotide change in exon 4, the other being a complex intronic mutation disrupting splicing of exon 13. In contrast to CEM/20xAraC cells, CEM/4xAraC cells did not bind the hENT1/SLC29A1 ligand nitrobenzylmercaptopurine ribonucleoside and lacked detectable hENT1/SLC29A1 protein. In CEM/20xAraC cells, independent intronic mutations impairing splicing of exons 2 and 3 were found at each allele of the deoxycytidine kinase gene. These studies point to at least two distinct mechanisms of AraC resistance in leukemic cells.
Pulse
Views:
1
Posts:
No posts
Rating:
Not rated
Publication
Journal: Diabetes
July/10/2011
Abstract
OBJECTIVE
To determine whether insulin reverses gestational diabetes mellitus (GDM)-reduced expression and activity of human equilibrative nucleoside transporters 1 (hENT1) in human umbilical vein endothelium cells (HUVECs).
METHODS
Primary cultured HUVECs from full-term normal (n = 44) and diet-treated GDM (n = 44) pregnancies were used. Insulin effect was assayed on hENT1 expression (protein, mRNA, SLC29A1 promoter activity) and activity (initial rates of adenosine transport) as well as endothelial nitric oxide (NO) synthase activity (serine(1177) phosphorylation, l-citrulline formation). Adenosine concentration in culture medium and umbilical vein blood (high-performance liquid chromatography) as well as insulin receptor A and B expression (quantitative PCR) were determined. Reactivity of umbilical vein rings to adenosine and insulin was assayed by wire myography. Experiments were in the absence or presence of l-N(G)-nitro-l-arginine methyl ester (l-NAME; NO synthase inhibitor) or ZM-241385 (an A(2A)-adenosine receptor antagonist).
RESULTS
Umbilical vein blood adenosine concentration was higher, and the adenosine- and insulin-induced NO/endothelium-dependent umbilical vein relaxation was lower in GDM. Cells from GDM exhibited increased insulin receptor A isoform expression in addition to the reported NO-dependent inhibition of hENT1-adenosine transport and SLC29A1 reporter repression, and increased extracellular concentration of adenosine and NO synthase activity. Insulin reversed all these parameters to values in normal pregnancies, an effect blocked by ZM-241385 and l-NAME.
CONCLUSIONS
GDM and normal pregnancy HUVEC phenotypes are differentially responsive to insulin, a phenomenon where insulin acts as protecting factor for endothelial dysfunction characteristic of this syndrome. Abnormal adenosine plasma levels, and potentially A(2A)-adenosine receptors and insulin receptor A, will play crucial roles in this phenomenon in GDM.
Publication
Journal: Placenta
June/6/2011
Abstract
Human endothelial dysfunction is a common feature in many diseases of pregnancy, such as gestational diabetes (GD). Metabolic changes include abnormal synthesis of nitric oxide (NO) and abnormal membrane transport of l-arginine and adenosine in primary cultures of human umbilical vein (HUVEC, macrovascular) and placental microvillus (hPMEC, microvascular) endothelial cells. These alterations are associated with modifications in the expression and activity of endothelial (eNOS) and inducible (iNOS) NO synthases, respectively, an effect that is maintained at least up to passage 5 in culture. HUVEC and hPMEC exhibit expression and activity of the human cationic amino acid transporter 1 (hCAT-1), equilibrative nucleoside transporters 1 (hENT1) and hENT2, as well as the corresponding SLC7A1, SLC29A1 and SLC29A2 gene promoter activities. Altered gene expression results from increased NO level, protein kinase C, mitogen-activated protein kinases, and hCHOP-C/EBPα transcription factor activation. Reduced ENT-mediated adenosine transport in GD is associated with stimulation of the l-arginine/NO pathway, and mainly due to reduced expression and activity of hENT1. In addition, hENT2 activity seems able to restore the reduced adenosine transport in GD. Additionally, insulin exerts a differential modulation of endothelial cells from macrocirculation compared with microcirculation, possibly due to expression of different insulin receptor isoforms. It is suggested that a common functional characteristic leading to changes in the bioavailability of adenosine and metabolism of l-arginine is evidenced by human fetal micro and macrovascular endothelium in GD.
Publication
Journal: European Journal of Pharmacology
July/19/2004
Abstract
Systemic disposition of nucleosides and nucleoside analogs is dependent on renal handling of these compounds. There are five known, functionally characterized nucleoside transporters with varying substrate specificities for nucleosides: concentrative nucleoside transporters (CNT1-CNT3; Solute Carrier (SLC) 28A1-28A3), which mediate the intracellular flux of nucleosides, and equilibrative nucleoside transporters (ENT1-ENT2; SLC29A1-SLC29A2), which mediate bi-directional facilitated diffusion of nucleosides. All five of these transporters are expressed in the kidney. Concentrative nucleoside transporters primarily localize to the apical membrane of renal epithelial cells while equilibrative nucleoside transporters primarily localize to the basolateral membrane. These transporters work in concert to mediate reabsorptive flux of naturally occurring nucleosides and nucleoside analogs. In addition, equilibrative transporters also participate in secretory flux of some nucleoside analogs. Nucleoside transporters also serve in the targeting of nucleoside analog therapies to renal tumors. This review examines the role that these transporters play in renal disposition of nucleosides and nucleoside analogs in both systemic and kidney-specific therapies.
Publication
Journal: Drug Metabolism and Pharmacokinetics
September/25/2006
Abstract
Thirty-nine genetic variations, including thirty novel ones, were found in the human SLC29A1 gene, which encodes equilibrative nucleoside transporter 1, from 256 Japanese cancer patients administered gemcitabine. The found novel variations included -8,166G>A, -81,10A>G, -7,947G>A, -7,789T>C, -5,595G>A, -3,803_-3,783delTCGGGGAGGTGGCAGTGGGCG, -3,548G>C, -3,414G>A, -1355T>C, -34C>G, IVS1+141G>A, IVS1+260C>T, IVS1-82C>T, 177C>G, IVS3-6C>T, 564C>T, IVS8+44T>C, IVS8+90T>C, IVS8+97T>C, IVS8+131C>T, IVS8+169G>A, 933T>C, 954C>T, IVS11-52G>C, IVS11-46G>A, 1,288G>A, 1,641C>G, 1,703_1,704delGT, 1812C>T, and 1861C>T. The frequencies were 0.051 for IVS8+169G>A, 0.012 for -7,947G>A, 0.006 for IVS1+141G>A and 1,703_1,704delGT, 0.004 for -8,166G>A, -8,110A>G, -3,548G>C, -1,355T>C, -34C>G, IVS8+44T>C, and 1,812C>T, and 0.002 for the other 19 variations. Among them, 177C>G and 1,288G>A resulted in amino acid substitutions Asp59Glu and Ala430Thr, respectively. Using the detected polymorphisms, linkage disequilibrium analysis was performed, and 28 haplotypes were identified or inferred. Our findings would provide fundamental and useful information for genotyping SLC29A1 in the Japanese and probably other Asian populations.
Publication
Journal: PLoS ONE
November/11/2014
Abstract
BACKGROUND
Different DNA aberrations processes can cause colorectal cancer (CRC). Herein, we conducted a comprehensive molecular characterization of 27 CRCs from Iranian patients.
METHODS
Array CGH was performed. The MSI phenotype and the methylation status of 15 genes was established using MSP. The CGH data was compared to two established lists of 41 and 68 cancer genes, respectively, and to CGH data from African Americans. A maximum parsimony cladogram based on global aberrations was established.
RESULTS
The number of aberrations seem to depend on the MSI status. MSI-H tumors displayed the lowest number of aberrations. MSP revealed that most markers were methylated, except RNF182 gene. P16 and MLH1 genes were primarily methylated in MSI-H tumors. Seven markers with moderate to high frequency of methylation (SYNE1, MMP2, CD109, EVL, RET, LGR and PTPRD) had very low levels of chromosomal aberrations. All chromosomes were targeted by aberrations with deletions more frequent than amplifications. The most amplified markers were CD248, ERCC6, ERGIC3, GNAS, MMP2, NF1, P2RX7, SFRS6, SLC29A1 and TBX22. Most deletions were noted for ADAM29, CHL1, CSMD3, FBXW7, GALNS, MMP2, NF1, PRKD1, SMAD4 and TP53. Aberrations targeting chromosome X were primarily amplifications in male patients and deletions in female patients. A finding similar to what we reported for African American CRC patients.
CONCLUSIONS
This first comprehensive analysis of CRC Iranian tumors reveals a high MSI rate. The MSI tumors displayed the lowest level of chromosomal aberrations but high frequency of methylation. The MSI-L were predominantly targeted with chromosomal instability in a way similar to the MSS tumors. The global chromosomal aberration profiles showed many similarities with other populations but also differences that might allow a better understanding of CRC's clinico-pathological specifics in this population.
Publication
Journal: Cancer Chemotherapy and Pharmacology
October/22/2013
Abstract
OBJECTIVE
The aim of this study was to investigate the prognostic significance of fourteen anticancer drug-relevant solute carrier transporters (SLCs) in pancreatic cancer in the context of clinical-pathological characteristics and the KRAS mutation status of tumors.
METHODS
Tumors and non-neoplastic pancreatic tissues were obtained from 32 histologically verified patients with pancreatic ductal adenocarcinoma. The transcript profile of SLCs was assessed using quantitative real-time PCR. KRAS mutations in exon 2 were assessed by high-resolution melting analysis and confirmed by sequencing.
RESULTS
SLC22A3 and SLC22A18 were upregulated and SLC22A1, SLC22A2, SLC22A11, SLC28A1, SLC28A3 and SLC29A1 were downregulated when compared with non-neoplastic pancreatic tissues. Moreover, significantly lower levels of SLC22A1, SLC22A11 and SLC29A1 were found in tumors with angioinvasion. There was also a significantly higher transcript level of SLC28A1 in tumors with regional lymph nodes affected by metastasis. The study found that a high expression of SLC28A1 was significantly associated with poor overall survival in unselected patients. In contrast, a high expression of SLC22A3 or SLC29A3 was significantly associated with longer overall survival in patients treated with nucleoside analogs. Protein expression of SLC22A1, SLC22A3 and SLC29A3 in tumor tissues of patients with pancreatic carcinoma was observed by immunoblotting for the first time. Finally, SLC levels were not found to be associated with KRAS mutation status in exon 2.
CONCLUSIONS
This study identified a number of associations of transcript levels of SLCs with prognosis of pancreatic cancer patients.
Publication
Journal: Liver International
August/9/2012
Abstract
BACKGROUND
Standard-dose ribavirin is crucial for the standard-of-care treatment of chronic hepatitis C virus (HCV) infection. Equilibrative nucleoside transporter 1 (ENT1), encoded by SLC29A1 gene, is the main transporter that imports ribavirin into human hepatocytes.
OBJECTIVE
To determine whether single nucleotide polymorphisms (SNPs) at the SLC29A1 gene could influence the probability of treatment response compared with other baseline and host genetic factors.
METHODS
A total of 526 East Asian patients monoinfected with HCV genotype 1b who had received pegylated interferon alpha plus ribavirin therapy were enrolled in this study. They were assigned randomly to the derivation and confirmatory groups. SNPs related to the IL28B, ITPA and SLC29A1 genes were genotyped using real-time detection polymerase chain reaction. Factors associated with sustained virological response (SVR) were analysed using multiple logistic regression analysis.
RESULTS
Multivariate analysis for the derivation group identified six baseline variables significantly and independently associated with SVR: age [P = 0.023, odds ratio (OR) = 0.97], gender (P = 0.0047, OR = 2.25), platelet count (P = 0.00017, OR = 1.11), viral load (P = 0.00026, OR = 0.54), IL28B SNP rs12979860 (P = 1.09 × 10(-7) , OR = 8.68) and SLC29A1 SNP rs6932345 (P = 0.030, OR = 1.85). Using the model constructed by these independent variables, positive and negative predictive values and predictive accuracy were 73.3, 70.1 and 71.9% respectively. For the confirmatory group, they were 71.4, 84.6 and 75.3% respectively. The SLC29A1 and IL28B SNPs were also significantly associated with rapid virological response.
CONCLUSIONS
The SNP at the major ribavirin transporter ENT1 gene SLC29A1 was one of significantly independent factors influencing treatment response, although the impact on the prediction was small.
Pulse
Views:
1
Posts:
No posts
Rating:
Not rated
Publication
Journal: PLoS ONE
August/1/2011
Abstract
BACKGROUND
Adenosine is involved in several neurological and behavioral disorders including alcoholism. In cultured cell and animal studies, type 1 equilibrative nucleoside transporter (ENT1, slc29a1), which regulates adenosine levels, is known to regulate ethanol sensitivity and preference. Interestingly, in humans, the ENT1 (SLC29A1) gene contains a non-synonymous single nucleotide polymorphism (647 T/C; rs45573936) that might be involved in the functional change of ENT1.
RESULTS
Our functional analysis showed that prolonged ethanol exposure increased adenosine uptake activity of mutant cells (ENT1-216Thr) compared to wild-type (ENT1-216Ile) transfected cells, which might result in reduced extracellular adenosine levels. We found that mice lacking ENT1 displayed increased propensity to ethanol withdrawal seizures compared to wild-type littermates. We further investigated a possible association of the 647C variant with alcoholism and the history of alcohol withdrawal seizures in subjects of European ancestry recruited from two independent sites. Analyses of the combined data set showed an association of the 647C variant and alcohol dependence with withdrawal seizures at the nominally significant level.
CONCLUSIONS
Together with the functional data, our findings suggest a potential contribution of a genetic variant of ENT1 to the development of alcoholism with increased risk of alcohol withdrawal-induced seizures in humans.
Publication
Journal: Clinical Pharmacokinetics
October/4/2010
Abstract
OBJECTIVE
Gemcitabine (2',2'-difluorodeoxycytidine) is an anticancer drug, which is effective against solid tumours, including non-small-cell lung cancer and pancreatic cancer. After gemcitabine is transported into cells by equilibrative and concentrative nucleoside transporters, it is phosphorylated by deoxycytidine kinase (DCK) and further phosphorylated to its active diphosphorylated and triphosphorylated forms. Gemcitabine is rapidly metabolized by cytidine deaminase (CDA) to an inactive metabolite, 2',2'-difluorodeoxyuridine (dFdU), which is excreted into the urine. Toxicities of gemcitabine are generally mild, but unpredictable severe toxicities such as myelosuppression and interstitial pneumonia are occasionally encountered. The aim of this study was to determine the factors, including genetic polymorphisms of CDA, DCK and solute carrier family 29A1 (SLC29A1 [hENT1]), that alter the pharmacokinetics of gemcitabine in Japanese cancer patients.
METHODS
250 Japanese cancer patients who received 30-minute intravenous infusions of gemcitabine at 800 or 1000 mg/m2 in the period between September 2002 and July 2004 were recruited for this study. However, four patients were excluded from the final model built in this study because they showed bimodal concentration-time curves. Two patients who experienced gemcitabine-derived life-threatening toxicities in October 2006 and January 2008 were added to this analysis. One of these patients received 30-minute intravenous infusions of gemcitabine at 454 mg/m2 instead of the usual dose (1000 mg/m2). Plasma concentrations of gemcitabine and dFdU were measured by high-performance liquid chromatography-photodiode array/mass spectrometry. In total, 1973 and 1975 plasma concentrations of gemcitabine and dFdU, respectively, were used to build population pharmacokinetic models using nonlinear mixed-effects modelling software (NONMEM version V level 1.1).
CONCLUSIONS
Two-compartment models fitted well to plasma concentration-time curves for both gemcitabine and dFdU. Major contributing factors for gemcitabine clearance were genetic polymorphisms of CDA, including homozygous CDA*3 [208G>A (Ala70Thr)] (64% decrease), heterozygous *3 (17% decrease) and CDA -31delC (an approximate 7% increase per deletion), which has a strong association with CDA*2 [79A>C (Lys27Gln)], and coadministered S-1, an oral, multicomponent anti-cancer drug mixture consisting of tegafur, gimeracil and oteracil (an approximate 19% increase). The estimated contribution of homozygous CDA*3 to gemcitabine clearance provides an explanation for the life-threatening severe adverse reactions, including grade 4 neutropenia observed in three Japanese patients with homozygous CDA*3. Genetic polymorphisms of DCK and SLC29A1 (hENT1) had no significant correlation with gemcitabine pharmacokinetic parameters. Aging and increased serum creatinine levels correlated with decreased dFdU clearance.
CONCLUSIONS
A population pharmacokinetic model that included CDA genotypes as a covariate for gemcitabine and dFdU in Japanese cancer patients was successfully constructed. The model confirms the clinical importance of the CDA*3 genotype.
Pulse
Views:
3
Posts:
No posts
Rating:
Not rated
Publication
Journal: Cardiovascular Research
June/23/2010
Abstract
OBJECTIVE
Reduced expression of human equilibrative nucleoside transporter 1 (hENT1) results from nitric oxide (NO)-dependent reduced SLC29A1 transcriptional activity in human umbilical vein endothelial cells (HUVECs) from gestational diabetes. As expression of the transcription factor C/EBP homologous protein 10 (hCHOP, which forms heterodimers with C/EBPalpha transcription factor) is activated by NO and induced in diabetes mellitus, we hypothesize that hCHOP plays a role in the gestational diabetes-reduced hENT1 expression in HUVECs.
RESULTS
HUVEC primary cultures from 42 normal and 42 gestational diabetic pregnancies were used for adenosine uptake assays. Real-time PCR (mRNA quantification), western blotting (protein abundance), and luciferase activity (SLC29A1 promoter activity) were used. hCHOP-C/EBPalpha activity was assayed by chromatin immunoprecipitation. Overlap extension mutagenesis was used to generate a mutated hCHOP-C/EBPalpha consensus site at the SLC29A1 promoter, and endothelial NO synthase (eNOS) siRNA recombinant adenovirus was used to knock down eNOS. hCHOP nuclear protein abundance and binding to DNA were higher in gestational diabetes, paralleled by reduced SLC29A1 promoter activity, hENT1 expression, and transport activity. These changes were blocked by hCHOP consensus sequence mutation (-1845G>> T and -1844C>> A), eNOS-siRNA-induced knockdown, and N(G)-nitro-L-arginine methyl ester (NOS inhibitor), and were mimicked by S-nitroso-N-acetyl-L, D-penicillamine (NO donor) in cells from normal pregnancies. hCHOP and C/EBPalpha overexpression mimicked gestational diabetes effects in cells from normal pregnancies, but did not alter SLC29A1 promoter activity or hENT1-adenosine transport in cells from gestational diabetes.
CONCLUSIONS
The hCHOP-C/EBPalpha complex down-regulates SLC29A1 expression in an NO-dependent manner in HUVECs from gestational diabetes.
Publication
Journal: Blood
September/28/2005
Abstract
To elucidate interpatient variability in thioguanine nucleotide (TGN) concentrations in acute lymphoblastic leukemia (ALL) cells, we determined the TGN concentrations in leukemic blasts from 82 children with newly diagnosed ALL after intravenous administration of mercaptopurine (MP). Patients treated with MP alone achieved higher TGN concentrations than those treated with the combination of methotrexate plus mercaptopurine (MTX + MP). Analysis of the expression of approximately 9600 genes in ALL cells obtained at diagnosis identified 60 gene probes significantly associated with TGN accumulation in patients treated with MP alone and 75 gene probes in patients treated with MTX + MP, with no overlap between the 2 sets of genes. Genes significantly associated with intracellular TGN accumulation after MP alone included those encoding MP metabolic enzymes and transporters (eg, SLC29A1). Inhibition of SLC29A1 by nitrobenzylmercaptopurine ribonucleoside (NBMPR) caused a 33% to 45% reduction of TGN in ALL cells in vitro (P < .006), consistent with the gene expression findings. Genes associated with TGN concentration after combination therapy included those involved in protein and adenosine triphosphate (ATP)-biosynthesis. Together, these in vivo and in vitro data provide new insight into the genomic basis of interpatient differences in intracellular TGN accumulation and reveal significant differences between treatment with MP alone and treatment with MP and MTX.
Publication
Journal: Biochemistry and Cell Biology
March/26/2007
Abstract
Renal handling of physiological and pharmacological nucleosides is a major determinant of their plasma levels and tissue availabilities. Additionally, the pharmacokinetics and normal tissue toxicities of nucleoside drugs are influenced by their handling in the kidney. Renal reabsorption or secretion of nucleosides is selective and dependent on integral membrane proteins, termed nucleoside transporters (NTs) present in renal epithelia. The 7 known human NTs (hNTs) exhibit varying permeant selectivities and are divided into 2 protein families: the solute carrier (SLC) 29 (SLC29A1, SLC29A2, SLC29A3, SLC29A4) and SLC28 (SLC28A1, SLC28A2, SLC28A3) proteins, otherwise known, respectively, as the human equilibrative NTs (hENTs, hENT1, hENT2, hENT3, hENT4) and human concentrative NTs (hCNTs, hCNT1, hCNT2, hCNT3). The well characterized hENTs (hENT1 and hENT2) are bidirectional facilitative diffusion transporters in plasma membranes; hENT3 and hENT4 are much less well known, although hENT3, found in lysosomal membranes, transports nucleosides and is pH dependent, whereas hENT4-PMAT is a H+-adenosine cotransporter as well as a monoamine-organic cation transporter. The 3 hCNTs are unidirectional secondary active Na+-nucleoside cotransporters. In renal epithelial cells, hCNT1, hCNT2, and hCNT3 at apical membranes, and hENT1 and hENT2 at basolateral membranes, apparently work in concert to mediate reabsorption of nucleosides from lumen to blood, driven by Na+ gradients. Secretion of some physiological nucleosides, therapeutic nucleoside analog drugs, and nucleotide metabolites of therapeutic nucleoside and nucleobase drugs likely occurs through various xenobiotic transporters in renal epithelia, including organic cation transporters, organic anion transporters, multidrug resistance related proteins, and multidrug resistance proteins. Mounting evidence suggests that hENT1 may have a presence at both apical and basolateral membranes of renal epithelia, and thus may participate in both selective secretory and reabsorptive fluxes of nucleosides. In this review, the renal handling of nucleosides is examined with respect to physiological and clinical implications for the regulation of human kidney NTs and adenosine signaling, intracellular nucleoside transport, and nephrotoxicities associated with some nucleoside drugs.
Publication
Journal: BMC Genomics
August/31/2017
Abstract
Colorectal cancer (CRC) is one of the most common malignant tumors worldwide. CRC molecular pathogenesis is heterogeneous and may be followed by mutations in oncogenes and tumor suppressor genes, chromosomal and microsatellite instability, alternative splicing alterations, hypermethylation of CpG islands, oxidative stress, impairment of different signaling pathways and energy metabolism. In the present work, we have studied the alterations of alternative splicing patterns of genes related to energy metabolism in CRC.
Using CrossHub software, we analyzed The Cancer Genome Atlas (TCGA) RNA-Seq datasets derived from colon tumor and matched normal tissues. The expression of 1014 alternative mRNA isoforms involved in cell energy metabolism was examined. We found 7 genes with differentially expressed alternative transcripts whereas overall expression of these genes was not significantly altered in CRC. A set of 8 differentially expressed transcripts of interest has been validated by qPCR. These eight isoforms encoded by OGDH, COL6A3, ICAM1, PHPT1, PPP2R5D, SLC29A1, and TRIB3 genes were up-regulated in colorectal tumors, and this is in concordance with the bioinformatics data. The alternative transcript NM_057167 of COL6A3 was also strongly up-regulated in breast, lung, prostate, and kidney tumors. Alternative transcript of SLC29A1 (NM_001078177) was up-regulated only in CRC samples, but not in the other tested tumor types.
We identified tumor-specific expression of alternative spliced transcripts of seven genes involved in energy metabolism in CRC. Our results bring new knowledge on alternative splicing in colorectal cancer and suggest a set of mRNA isoforms that could be used for cancer diagnosis and development of treatment methods.
Pulse
Views:
1
Posts:
No posts
Rating:
Not rated
Publication
Journal: Biochimica et Biophysica Acta - General Subjects
April/7/2013
Abstract
The widely expressed, homo-oligomeric, lipid raft-associated, monotopic integral membrane protein stomatin and its homologues are known to interact with and modulate various ion channels and transporters. Stomatin is a major protein of the human erythrocyte membrane, where it associates with and modifies the glucose transporter GLUT1; however, previous attempts to purify hetero-oligomeric stomatin complexes for biochemical analysis have failed. Because lateral interactions of membrane proteins may be short-lived and unstable, we have used in situ chemical cross-linking of erythrocyte membranes to fix the stomatin complexes for subsequent purification by immunoaffinity chromatography. To further enrich stomatin, we prepared detergent-resistant membranes either before or after cross-linking. Mass spectrometry of the isolated, high molecular, cross-linked stomatin complexes revealed the major interaction partners as glucose transporter-1 (GLUT1), anion exchanger (band 3), and water channel (aquaporin-1). Moreover, ferroportin-1 (SLC40A1), urea transporter-1 (SLC14A1), nucleoside transporter (SLC29A1), the calcium-pump (Ca-ATPase-4), CD47, and flotillins were identified as stomatin-interacting proteins. These findings are in line with the hypothesis that stomatin plays a role as membrane-bound scaffolding protein modulating transport proteins.
Publication
Journal: Clinical Cancer Research
August/15/2010
Abstract
OBJECTIVE
Previous preclinical studies suggested that concurrent capecitabine and radiation could be an effective new treatment modality for glioblastoma (GBM). In the current study, we investigate toxicity and response to this regimen and explore associations between gene expression and patient outcome.
METHODS
Eighteen newly diagnosed GBM patients received concurrent capecitabine at 625 mg/m2 BID (25% escalation) and irradiation (60 Gy total) for 6 weeks followed by 4 weeks of capecitabine only. Maintenance capecitabine was administered for 14 days every 3 weeks until progression or unacceptable toxicity. Expression analysis of 94 genes involved in capecitabine metabolism and radiation response was done on tissues obtained before therapy. The relationship of gene expression with time-to-progression (TTP) and overall survival (OS) was investigated using univariate Cox proportional hazards regression, semi-supervised principle component analysis, and class prediction modeling.
RESULTS
The maximum tolerated dose of capecitabine was 625 mg/m2 BID. Median patient TTP and OS were 247 and 367 days, respectively. Cox regression identified 24 genes significantly (P<0.025) associated with patient outcome. Semi-supervised principle component analysis identified two patient populations significantly different in both TTP (P=0.005) and OS (P=0.015). Class prediction modeling determined that eight genes (RAD54B, MTOR, DCTD, APEX2, TK1, RRM2, SLC29A1, and ERCC6) could collectively classify patients into outcome subgroups with 100% accuracy and precision.
CONCLUSIONS
Capecitabine and concurrent radiation for newly diagnosed GBM seems to be well tolerated and comparable to temozolomide and radiation. A gene expression profile predictive of patient outcome that may be useful in patient stratification for therapy was also elucidated.
Publication
Journal: FASEB Journal
April/29/2015
Abstract
Reduced adenosine uptake via human equilibrative nucleoside transporter 1 (hENT1) in human umbilical vein endothelial cells (HUVECs) from gestational diabetes mellitus (GDM) is reversed by insulin by restoring hENT1 expression. Insulin receptors A (IR-A) and B (IR-B) are expressed in HUVECs, and GDM results in higher IR-A mRNA expression vs. cells from normal pregnancies. We studied whether the reversal of GDM effects on transport by insulin depends on restoration of IR-A expression. We specifically measured hENT1 expression [mRNA, protein abundance, SLC29A1 (for hENT1) promoter activity] and activity (adenosine transport kinetics) and the role of IR-A/IR-B expression and signaling [total and phosphorylated 42 and 44 kDa mitogen-activated protein kinases (p44/42(mapk)) and Akt] in IR-A, IR-B, and IR-A/B knockdown HUVECs from normal (n = 33) or GDM (n = 33) pregnancies. GDM increases IR-A/IR-B mRNA expression (1.8-fold) and p44/42(mapk):Akt activity (2.7-fold) ratios. Insulin reversed GDM-reduced hENT1 expression and maximal transport capacity (V(max)/K(m)), and GDM-increased IR-A/IR-B mRNA expression and p44/42(mapk):Akt activity ratios to values in normal pregnancies. Insulin's effect was abolished in IR-A or IR-A/B knockdown cells. Thus, insulin requires normal IR-A expression and p44/42(mapk)/Akt signaling to restore GDM-reduced hENT1 expression and activity in HUVECs. This could be a protective mechanism for the placental macrovascular endothelial dysfunction seen in GDM.
Pulse
Views:
2
Posts:
No posts
Rating:
Not rated
Publication
Journal: Pediatric Blood and Cancer
November/17/2014
Abstract
BACKGROUND
Precision (Personalized) medicine has the potential to revolutionize patient health care especially for many cancers where the fundamental disease etiology remains either elusive or has no available therapy. Here we outline a study in alveolar rhabdomyosarcoma, in which we use gene expression profiling and a series of drug prediction algorithms combined with a matched patient-derived xenograft (PDX) model to test bioinformatically predicted therapies.
METHODS
A PDX model was developed from a patient biopsy and a number of drugs identified using gene expression analysis in combination with drug prediction algorithms. Drugs chosen from each of the predictive methodologies, along with the patient's standard-of-care therapy (ICE-T), were tested in vivo in the PDX tumor. A second study was initiated using the tumors that re-grew following the ICE-T treatment. Further expression analysis identified additional therapies with potential anti-tumor efficacy.
RESULTS
A number of the predicted therapies were found to be active against the tumors in particular BGJ398 (FGFR2) and ICE-T. Re-transplanted ICE-T treated tumorgrafts demonstrated a decreased response to ICE-T recapitulating the patient's refractory disease. Gene expression profiling of the ICE-T treated tumorgrafts identified cytarabine (SLC29A1) as a potential therapy, which was shown, along with BGJ398, to be highly active in vivo.
CONCLUSIONS
This study illustrates that PDX models are suitable surrogates for testing potential therapeutic strategies based on gene expression analysis, modeling clinical drug resistance and hold the potential to assist in guiding prospective patient care.
Publication
Journal: npj Genomic Medicine
August/31/2020
Abstract
A new global pandemic of coronavirus disease 2019 (COVID-19) has resulted in high mortality and morbidity. Currently numerous drugs are under expedited investigations without well-established safety or efficacy data. Pharmacogenomics may allow individualization of these drugs thereby improving efficacy and safety. In this review, we summarized the pharmacogenomic literature available for COVID-19 drug therapies including hydroxychloroquine, chloroquine, azithromycin, remdesivir, favipiravir, ribavirin, lopinavir/ritonavir, darunavir/cobicistat, interferon beta-1b, tocilizumab, ruxolitinib, baricitinib, and corticosteroids. We searched PubMed, reviewed the Pharmacogenomics Knowledgebase (PharmGKB®) website, Clinical Pharmacogenetics Implementation Consortium (CPIC) guidelines, the U.S. Food and Drug Administration (FDA) pharmacogenomics information in the product labeling, and the FDA pharmacogenomics association table. We found several drug-gene variant pairs that may alter the pharmacokinetics of hydroxychloroquine/chloroquine (CYP2C8, CYP2D6, SLCO1A2, and SLCO1B1); azithromycin (ABCB1); ribavirin (SLC29A1, SLC28A2, and SLC28A3); and lopinavir/ritonavir (SLCO1B1, ABCC2, CYP3A). We also identified other variants, that are associated with adverse effects, most notable in hydroxychloroquine/chloroquine (G6PD; hemolysis), ribavirin (ITPA; hemolysis), and interferon β -1b (IRF6; liver toxicity). We also describe the complexity of the risk for QT prolongation in this setting because of additive effects of combining more than one QT-prolonging drug (i.e., hydroxychloroquine/chloroquine and azithromycin), increased concentrations of the drugs due to genetic variants, along with the risk of also combining therapy with potent inhibitors. In conclusion, although direct evidence in COVID-19 patients is lacking, we identified potential actionable genetic markers in COVID-19 therapies. Clinical studies in COVID-19 patients are deemed warranted to assess potential roles of these markers.
Keywords: Genetic markers; Viral infection.
Pulse
Views:
2
Posts:
No posts
Rating:
Not rated
Publication
Journal: Journal of Biological Chemistry
November/15/2010
Abstract
Adenosine is a candidate modulator of sperm motility in the female reproductive tract that increases sperm flagellar beat frequency in vitro. Past work suggested that this acceleration may involve equilibrative (ENT) and concentrative (CNT) nucleoside transporters. Here we show that Slc29a1 (ENT-1) is the predominant nucleoside transporter expressed in the mouse testis. Unexpectedly, the beat of Slc29a1-null sperm still accelerates in response to 2-chloro-2'-deoxyadenosine (Cl-dAdo). Moreover, in wild-type sperm neither blockade of CNTs by removal of external Na(+), nor inhibition of ENTs with nitrobenzylthioionosine, prevents acceleration of the sperm beat by Cl-dAdo. In contrast, pertussis toxin produces strong blockade, indicating involvement of a Gα(i/o)-coupled adenosine receptor. Although agonists selective for adenosine receptors A1R, A2aR, and A2bR are ineffective, A3R-selective agonists Cl-IB-MECA and IB-MECA do accelerate the beat. Consistent with this pharmacological profile, the predominant Adora transcripts in the testis are products of the nested Adora3i1 and Adora3i2 genes. Surprisingly, Cl-IB-MECA and Cl-dAdo still accelerate the beat of Adora3i1-null sperm indicating that the remaining Adora3i2 transcript produces an A3R that functions in sperm. When cloned Adora3i2 is heterologously expressed in tsA-201 cells, Cl-dAdo decreases forskolin-evoked accumulation of cAMP, indicating that Adora3i2 specifies a functional A3Ri2 adenosine receptor that couples through Gα(i). Database mining reveals that mouse Adora3i2 is expressed primarily in testis, almost exclusively in spermatids. Expression of the orthologous ADORA3i3 transcript also is most prominent in human testis; presumably producing an A3Ri3 receptor that is functional in sperm and that may be a target for development of male-directed contraceptives.
Publication
Journal: Blood
August/11/2015
Abstract
The Augustine-negative alias At(a-) blood type, which seems to be restricted to people of African ancestry, was identified half a century ago but remains one of the last blood types with no known genetic basis. Here we report that a nonsynonymous single nucleotide polymorphism in SLC29A1 (rs45458701) is responsible for the At(a-) blood type. The resulting p.Glu391Lys variation in the last extracellular loop of the equilibrative nucleoside transporter 1 (ENT1; also called SLC29a1) is known not to alter its ability to transport nucleosides and nucleoside analog drugs. Furthermore, we identified 3 individuals of European ancestry who are homozygous for a null mutation in SLC29A1 (c.589+1G>C) and thus have the Augustine-null blood type. These individuals lacking ENT1 exhibit periarticular and ectopic mineralization, which confirms an important role for ENT1/SLC29A1 in human bone homeostasis as recently suggested by the skeletal phenotype of aging Slc29a1(-/-) mice. Our results establish Augustine as a new blood group system and place SLC29A1 as a new candidate gene for idiopathic disorders characterized with ectopic calcification/mineralization.
Publication
Journal: European Journal of Cancer
April/13/2014
Abstract
BACKGROUND
Paclitaxel and gemcitabine (PG) combination chemotherapy is effective as a maintenance chemotherapeutic regimen in metastatic breast cancer (MBC) patients because it increases progression-free survival (PFS), which increases overall survival (OS). The primary purpose of our study was to investigate the association between genetic polymorphisms in the genes involved in PG pathways and clinical outcomes in MBC patients treated with PG chemotherapy.
METHODS
A total of 324 MBC patients were enrolled in this prospective multicenter trial of PG as the first-line chemotherapy. Eighty-five of the 324 patients from two institutes were available for analysis of single nucleotide polymorphisms (SNPs). Germline DNA was extracted from peripheral blood mononuclear cells. Thirty-eight SNPs in 15 candidate genes selected from pathways that may influence the metabolism and transport of, or sensitivity, to PG were analysed.
RESULTS
The median PFS and OS of all 324 patients were 8.7 months (95% confidence interval [CI]: 7.5-9.6 months) and 26.9 months (95% CI: 23.6-30.1 months), respectively. An SNP in SLC28A3 (rs7867504, C/T) was associated with OS (CC or CT versus TT: 37 versus 21 months, p = 0.027, hazard ratio [HR] 2.6, 95% CI: 1.1-6.3). SLC29A1 GA haplotype had a significantly shorter OS (p = 0.030, HR 3.391, 95% CI: 1.13-10.19). RRM1 (ribonucleotide reductase large subunit M1) SNP (rs9937), and haplotypes ATAA and ATGA were significantly associated with neurotoxicity.
CONCLUSIONS
Genetic polymorphisms in SLC28A3, SLC29A1 and RRM1 can influence the clinical outcome of MBC patients treated with PG chemotherapy. Further studies on the functional mechanisms relating to these germline polymorphisms in these genes are warranted.
Pulse
Views:
2
Posts:
No posts
Rating:
Not rated
load more...