BACKGROUND

The inhibition of estrogen receptor (ER) α action with the ER antagonist tamoxifen is an established treatment in the majority of breast cancers. De novo or acquired resistance to this therapy is common. Expression of ERβ in breast tumors has been implicated as an indicator of tamoxifen sensitivity. The mechanisms behind this observation remain largely uncharacterized. In the present study, we investigated whether ERβ can modulate pathways implicated in endocrine resistance development.

METHODS

T47-D and MCF-7 ERα-expressing breast cancer cells with tetracycline-regulated expression of ERβ were used as a model system. Expression levels and activity of known regulators of endocrine resistance were analyzed by performing quantitative polymerase chain reaction assays, Western blot analysis and immunostaining, and sensitivity to tamoxifen was investigated by using a cell proliferation kit.

RESULTS

Expression of ERβ in ERα-positive T47-D and MCF-7 human breast cancer cells resulted in a decrease in Akt signaling. The active form of an upstream regulator of Akt, proto-oncogene c-ErbB-2/receptor tyrosine kinase erbB-3 (HER2/HER3) receptor dimer, was also downregulated by ERβ. Furthermore, ERβ increased expression of the important inhibitor of Akt, phosphatase and tensin homologue deleted on chromosome 10 (PTEN). Importantly, ERβ expression increased the sensitivity of these breast cancer cells to tamoxifen.

CONCLUSIONS

Our results suggest a link between expression of ERβ and endocrine sensitivity by increasing PTEN levels and decreasing HER2/HER3 signaling, thereby reducing Akt signaling with subsequent effects on proliferation, survival and tamoxifen sensitivity of breast cancer cells. This study supports initiatives to further investigate whether ERβ presence in breast cancer samples is an indicator for endocrine response. Current therapies in ERα-positive breast cancers aim to impair ERα activity with antagonists or by removal of endogenous estrogens with aromatase inhibitors. Data from this study could be taken as indicative for also using ERβ as a target in selected groups of breast cancer.

Hemorrhagic diathesis and widespread microthrombosis are common in heatstroke. To assess the early stages of coagulopathy in heatstroke, thrombin-antithrombin III (TAT), fibrin monomers, plasmin-alpha <em>2</em>-antiplasmin (PAP), plasminogen and <em>D</em>-<em>Dimer</em> were measured in 16 heatstroke patients (means +/- SE rectal temperature 4<em>2</em>.3 +/- 0.<em>2</em> degrees C) pre- and postcooling and compared with 8 heatstressed and <em>2</em>3 normal controls. Comparing heatstroke patients with normal controls, TAT, fibrin monomers, PAP and <em>D</em>-<em>Dimer</em> were elevated to (median (range)) 16.5 (4-1000) versus 3.5 (<em>2</em>-7.<em>2</em>) micrograms/l p < 0.001, 16 (4-113) versus <em>2</em> (<em>2</em>-9) nM p < 0.001; 3300 (1000-36500) versus <em>2</em>55 (136-46<em>2</em>) micrograms/l p < 0.001 and 0.7<em>2</em> (0.<em>2</em><em>2</em>-64.8) versus 0.15 (0.05-0.<em>2</em>5) microgram/ml p < 0.01 respectively. Plasminogen decreased to 81% (34-106); PAP, TAT and <em>D</em>-<em>Dimer</em> correlated significantly with hyperthermia (r = 0.577, p = 0.0<em>2</em>; r = 0.635, p = 0.01; r = 0.76, p = 0.003). Postcooling PAP decreased to 545 (<em>2</em>60-850) micrograms/l p < 0.005, TAT 10 (6-70) micrograms/l, and fibrin monomers <em>2</em><em>2</em> (18-86) nM remained unchanged. Heatstressed controls showed mild but significant increase in all markers. Activation of coagulation and fibrinolysis occurs early and is profound and sustained in heatstroke. Cooling seems to attenuate the activation of fibrinolysis only, however, this requires confirmation in a larger study population.

Background: The incidence, severity, and outcomes of AKI in COVID-19 varied in different reports. In patients critically ill with COVID-19, the clinicopathologic characteristics of AKI have not been described in detail.

Methods: This is a retrospective cohort study of 81 patients critically ill with COVID-19 in an intensive care unit. The incidence, etiologies, and outcomes of AKI were analyzed. Pathologic studies were performed in kidney tissues from ten deceased patients with AKI.

<strong class="sub-title"> Results: </strong> A total of 41 <b>(</b>50.6%) patients experienced AKI in this study. The median time from illness to AKI was <em>2</em>1.0 (IQR, 9.5-<em>2</em>6.0) days. The proportion of Kidney <em>D</em>isease Improving Global Outcomes (K<em>D</em>IGO) stage 1, stage <em>2</em>, and stage 3 AKI were <em>2</em>6.8%, 31.7%, and 41.5%, respectively. The leading causes of AKI included septic shock (<em>2</em>5 of 41, 61.0%), volume insufficiency (eight of 41, 19.5%), and adverse drug effects (five of 41, 1<em>2</em>.<em>2</em>%). The risk factors for AKI included age (per 10 years) (HR, 1.83; 95% CI, 1.<em>2</em>4 to <em>2</em>.69; <i>P</i>=0.00<em>2</em>) and serum IL-6 level (HR, 1.83; 95% CI, 1.<em>2</em>3 to <em>2</em>.73; <i>P</i>=0.003). K<em>D</em>IGO stage 3 AKI predicted death. Other potential risk factors for death included male sex, elevated <em>D</em>-<em>dimer</em>, serum IL-6 level, and higher Sequential Organ Failure Assessment score. The predominant pathologic finding was acute tubular injury. Nucleic acid tests and immunohistochemistry failed to detect the virus in kidney tissues.

Conclusions: AKI was a common and multifactorial complication in patients critically ill with COVID-19 at the late stage of the disease course. The predominant pathologic finding was acute tubular injury. Older age and higher serum IL-6 level were risk factors of AKI, and KDIGO stage 3 AKI independently predicted death.

Keywords: COVID-19; acute renal failure; critically ill; kidney disease; renal pathology.

The soluble Abeta oligomers in brain are highly correlated with memory related synaptic dysfunctions in Alzheimer's disease (A<em>D</em>). However, more recent studies implicate the involvement of Abeta <em>dimers</em> and trimers in memory related A<em>D</em> pathology. Apparently, Abeta oligomers can bind with cellular prion protein at the membrane receptors, forming annular amyloid pores and membrane ion channels to induce aberrant spine cytoskeletal changes. Hence synapse targeting of Abeta oligomers involves activation of many receptors such as N-Methyl-<em>D</em>-aspartate (NM<em>D</em>A), alpha-amino-3- hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA), nicotinic acetylcholine (nAChRs), p75 neurotrophin (p75NTR) following aberrant clustering of metabotropic glutamate receptors (mGluR5) leading to neuronal loss and LTP failure. In particular, NM<em>D</em>A and AMPA receptor activation by soluble amyloid oligomers involves calcium mediated mitochondrial dysfunction, decreased Ca((<em>2</em>+))/calmodulin-dependent protein kinase II (CaMKII) levels at the synapses accompanying dramatic loss of synaptic proteins such as postsynaptic density-95 (PS<em>D</em>-95), dynamin-1 and synaptophysin. This kind of receptor-Abeta oligomer interaction might eventually affect the neuronal membrane integrity by altering dielectric barrier, various synaptic proteins, spine morphology and density and P/Q calcium currents that might provoke a cascade of events leading to neuronal loss and memory failure. In this review, we try to explain in detail the various possible mechanisms that connect Abeta oligomers with synapse damage and memory failure.

Introduction: COVID-19 disease has spread worldwide from December 2019 to the present day; the early stage of this disease can be associated with high D-dimer, prolonged PT, and elevated levels of fibrinogen, indicating activation of coagulation pathways and thrombosis. In this article, we analyze the levels of D-dimer in patients with COVID-19.

Area covered: In the current study, three databases, PubMed, Scopus, Web of Science, searched using related keywords and information extracted from articles such as location, sample size, gender, age, coagulation test values, patient results, and disease severity.

Expert opinion: D-dimer level is one of the measures used in patients to detect thrombosis. Studies have reported an increase in D-dimer and fibrinogen concentrations in the early stages of COVID-19 disease a 3 to 4-fold rise in D-dimer levels is linked to poor prognosis. In addition, underlying diseases such as diabetes, cancer, stroke, and pregnancy may trigger an increase in D-dimer levels in COVID-19 patients. Measuring the level of D-dimer and coagulation parameters from the early stage of the disease can also be useful in controlling and managing of COVID-19 disease.

Keywords: COVID-19; Coagulopathy; Coronavirus; D-dimer; SARS-CoV-2.

<AbstractText>We compared clinical, laboratory, radiological, and outcome features of patients with SARS-CoV-<em>2</em> infection (COVI<em>D</em>-19) with pneumonia, with vs without diarrhea.</AbstractText><AbstractText>We performed a retrospective, single-center analysis of 84 patients with SARS-CoV-<em>2</em> pneumonia in Wuhan Union Hospital, China, from January 19 through February 7, <em>2</em>0<em>2</em>0. Cases were confirmed by real-time reverse-transcriptase PCR of nasal and pharyngeal swab specimens for SARS-CoV-<em>2</em> RNA. Blood samples were analyzed for white blood cell count, lymphocyte count, alanine aminotransferase, creatine kinase, lactate dehydrogenase, <em>D</em>-<em>dimer</em>, C-reactive protein, and in some cases, immunoglobulins, complement, lymphocyte subsets, and cytokines. Virus RNA was detected in stool samples by real-time PCR.</AbstractText><AbstractText>Of the 84 patients with SARS-CoV-<em>2</em> pneumonia, <em>2</em>6 (31%) had diarrhea. The duration of fever and dyspnea in patients with diarrhea was significantly longer than those without diarrhea (all P<.05). Stool samples from a higher proportion of patients with diarrhea tested positive for virus RNA (69%) than from patients without diarrhea (17%) (P<.001). As of February 19, a lower proportion of patients with diarrhea had a negative result from the latest throat swab for SARS-CoV-<em>2</em> (77%) than patients without diarrhea (97%) (P=.010), during these patients' hospitalization. Of 76 patients with a negative result from their latest throat swab test during hospitalization, a significantly higher proportion of patients with diarrhea had a positive result from the retest for SARS-CoV-<em>2</em> in stool (45%) than patients without diarrhea (<em>2</em>0%) (P=.039).</AbstractText><AbstractText>At a single center in Wuhan, China, 31% of patients with SARS-CoV-<em>2</em> pneumonia had diarrhea. A significantly higher proportion of patients with diarrhea have virus RNA in stool than patients without diarrhea. Elimination of SARS-CoV-<em>2</em> from stool takes longer than elimination from the nose and throat.</AbstractText>

<strong class="sub-title"> Background: </strong> Vaccine-induced immune thrombocytopenia and thrombosis (VITT) is a new syndrome associated with the ChAdOx1 nCoV-19 adenoviral vector vaccine against severe acute respiratory syndrome coronavirus <em>2</em>. Data are lacking on the clinical features of and the prognostic criteria for this disorder.

<strong class="sub-title"> Methods: </strong> We conducted a prospective cohort study involving patients with suspected VITT who presented to hospitals in the United Kingdom between March <em>2</em><em>2</em> and June 6, <em>2</em>0<em>2</em>1. Data were collected with the use of an anonymized electronic form, and cases were identified as definite or probable VITT according to prespecified criteria. Baseline characteristics and clinicopathological features of the patients, risk factors, treatment, and markers of poor prognosis were determined.

<strong class="sub-title"> Results: </strong> Among <em>2</em>94 patients who were evaluated, we identified 170 definite and 50 probable cases of VITT. All the patients had received the first dose of ChAdOx1 nCoV-19 vaccine and presented 5 to 48 days (median, 14) after vaccination. The age range was 18 to 79 years (median, 48), with no sex preponderance and no identifiable medical risk factors. Overall mortality was <em>2</em><em>2</em>%. The odds of death increased by a factor of <em>2</em>.7 (95% confidence interval [CI], 1.4 to 5.<em>2</em>) among patients with cerebral venous sinus thrombosis, by a factor of 1.7 (95% CI, 1.3 to <em>2</em>.3) for every 50% decrease in the baseline platelet count, by a factor of 1.<em>2</em> (95% CI, 1.0 to 1.3) for every increase of 10,000 fibrinogen-equivalent units in the baseline d-dimer level, and by a factor of 1.7 (95% CI, 1.1 to <em>2</em>.5) for every 50% decrease in the baseline fibrinogen level. Multivariate analysis identified the baseline platelet count and the presence of intracranial hemorrhage as being independently associated with death; the observed mortality was 73% among patients with platelet counts below 30,000 per cubic millimeter and intracranial hemorrhage.

Conclusions: The high mortality associated with VITT was highest among patients with a low platelet count and intracranial hemorrhage. Treatment remains uncertain, but identification of prognostic markers may help guide effective management. (Funded by the Oxford University Hospitals NHS Foundation Trust.).

BACKGROUND

Diabetes confers an increased risk for cardiovascular effects of airborne particles.

OBJECTIVE

We hypothesized that inhalation of elemental carbon ultrafine particles (UFP) would activate blood platelets and vascular endothelium in people with type <em>2</em> diabetes.

METHODS

In a randomized, double-blind, crossover trial, 19 subjects with type <em>2</em> diabetes inhaled filtered air or 50 µg/m³ elemental carbon UFP (count median diameter, 3<em>2</em> nm) by mouthpiece for <em>2</em> hr at rest. We repeatedly measured markers of vascular activation, coagulation, and systemic inflammation before and after exposure.

RESULTS

Compared with air, particle exposure increased platelet expression of CD40 ligand (CD40L) and the number of platelet-leukocyte conjugates 3.5 hr after exposure. Soluble CD40L decreased with UFP exposure. Plasma von Willebrand factor increased immediately after exposure. There were no effects of particles on plasma tissue factor, coagulation factors VII or IX, or D-dimer.

CONCLUSIONS

Inhalation of elemental carbon UFP for <em>2</em>-hr transiently activated platelets, and possibly the vascular endothelium, in people with type <em>2</em> diabetes.

The binding of Escherichia coli Gal repressor to linear DNA fragments containing two binding sites (OE and OI) within the gal operon was analyzed in vitro with quantitative footprint and mobility-shift techniques. In vivo analysis of the regulation of the gal operon [Haber, R., & Adhya, S. (1988) Proc. Natl. Acad. Sci. U.S.A. 85, 9683-9687] has suggested the role of a regulatory "looped complex" mediated by the association of Gal repressor <em>dimers</em> bound at OE and OI. The binding of Gal repressor to a single site can be described by a model in which monomer and <em>dimer</em> are in equilibrium and only the <em>dimer</em> binds to DNA. At pH 7.0, <em>2</em>5 mM KCl, and <em>2</em>0 degrees C, the binding and <em>dimer</em>ization free energies are comparable, suggesting that the equilibrium governing the formation of <em>dimers</em> may be important to regulation. The two intrinsic binding constants, <em>delta</em> GI and <em>delta</em> GE, and a constant describing cooperativity, <em>delta</em> GIE, were determined by footprint titration analysis as a function of pH, [KCl], and temperature. Only at 4 and 0 degrees C was <em>delta</em> GIE negative, signifying cooperative binding. These results are thought to be due to a weak <em>dimer</em> to tetramer association interface. <em>delta</em> GE and <em>delta</em> GI had maximal values between pH 6 and pH 7. The dependence of these constants on [KCl] corresponded to the displacement of approximately <em>2</em> ion equiv. The temperature dependence could be described by a change in the heat capacity, <em>delta</em> Cp, of -<em>2</em>.3 kcal mol-1 deg-1. Mobility-shift titration experiments conducted at <em>2</em>0 and 0 degrees C yielded values for <em>delta</em> GIE that were consistent with those resolved from the footprint analysis. Unique values of <em>delta</em> GIE were determined by analysis of mobility-shift titrations of Gal repressor with wild-type operator subject to the constraint that <em>delta</em> GE = <em>delta</em> GI: a procedure that eliminates the need to simultaneously analyze wild-type titrations with titrations of OE- and OI- operators.

Archaeosine tRNA-guanine transglycosylase (ArcTGT) catalyzes the exchange of guanine at position 15 in the <em>D</em>-loop of archaeal tRNAs with a free 7-cyano-7-deazaguanine (preQ(0)) base, as the first step in the biosynthesis of an archaea-specific modified base, archaeosine (7-formamidino-7-deazaguanosine). We determined the crystal structures of ArcTGT from Pyrococcus horikoshii at <em>2</em>.<em>2</em> A resolution and its complexes with guanine and preQ(0), at <em>2</em>.3 and <em>2</em>.5 A resolutions, respectively. The N-terminal catalytic domain folds into an (alpha/beta)(8) barrel with a characteristic zinc-binding site, showing structural similarity with that of the bacterial queuosine TGT (QueTGT), which is involved in queuosine (7-[[(4,5-cis-dihydroxy-<em>2</em>-cyclopenten-1-yl)-amino]methyl]-7-deazaguanosine) biosynthesis and targets the tRNA anticodon. ArcTGT forms a <em>dimer</em>, involving the zinc-binding site and the ArcTGT-specific C-terminal domain. The C-terminal domains have novel folds, including an OB fold-like "PUA domain", whose sequence is widely conserved in eukaryotic and archaeal RNA modification enzymes. Therefore, the C-terminal domains may be involved in tRNA recognition. In the free-form structure of ArcTGT, an alpha-helix located at the rim of the (alpha/beta)(8) barrel structure is completely disordered, while it is ordered in the guanine-bound and preQ(0)-bound forms. Structural comparison of the ArcTGT.preQ(0), ArcTGT.guanine, and QueTGT.preQ(1) complexes provides novel insights into the substrate recognition mechanisms of ArcTGT.

BACKGROUND

Activation markers of coagulation and fibrinolysis are increased in individuals at risk of coronary-artery disease and other thrombotic disorders--a condition defined as the prethrombotic state. We aimed to find out the extent to which the prethrombotic state is determined by genetic factors.

METHODS

We analysed concentrations of prothrombin, prothrombin fragment 1+<em>2</em>, thrombin-antithrombin complex, crosslinked fibrin degradation product <em>D</em>-<em>dimer</em>, and thrombin-activatable fibrinolysis inhibitor by ELISA in 118 monozygotic and 11<em>2</em> dizygotic unselected female twins aged <em>2</em>1-73 years from the St Thomas' UK Adult Twin Registry. We used quantitative genetic-model fitting to estimate heritability.

RESULTS

We found significant heritabilities in concentrations of the activation markers in plasma. Genetic factors contributed 45, 40, and 65% of the variation in concentrations of fragment 1+<em>2</em>, thrombin-antithrombin complex, and <em>D</em>-<em>dimer</em>, respectively. Age was important only in fragment 1+<em>2</em> concentrations, in which it accounted for 1<em>2</em>% of the variation. The remaining variation could be attributed to unique environmental factors. Variation in concentrations of precursor prothrombin in plasma was determined by 57% heritability, and that of zymogen thrombin-activatable fibrinolysis inhibitor showed a very strong genetic component (8<em>2</em>%).

CONCLUSIONS

The activation mechanisms of the coagulation and fibrinolytic systems, and therefore the prethrombotic state, are controlled to a substantial degree by genetic factors. Genes influencing activation of haemostasis are likely to be an important component of the overall thrombotic tendency in the general population.

Based on observations of solubility and folding properties of peptide 33-mers derived from the beta-sheet domains of platelet factor-4 (PF4), interleukin-8 (IL-8), and growth related protein (Gro-alpha), as well as other beta-sheet-forming peptides, general guidelines have been developed to aid in the design of water soluble, self-association-induced beta-sheet-forming peptides. C<em>D</em>, 1H-NMR, and pulsed field gradient NMR self-diffusion measurements have been used to assess the degree of folding and state of aggregation. PF4 peptide forms native-like beta-sheet tetramers and is sparingly soluble above pH 6. IL-8 peptide is insoluble between pH 4.5 and pH 7.5, yet forms stable, native-like beta-sheet <em>dimers</em> at higher pH. Gro-alpha peptide is soluble at all pH values, yet displays no discernable beta-sheet structure even when diffusion data indicate <em>dimer</em>-tetramer aggregation. A recipe used in the de novo design of water-soluble beta-sheet-forming peptides calls for the peptide to contain 40-50% hydrophobic residues, usually aliphatic ones (I, L, V, A, M) (appropriately paired and mostly but not always alternating with polar residues in the sheet sequence), a positively charged (K, R) to negatively charged (E, <em>D</em>) residue ratio between 4/<em>2</em> and 6/<em>2</em>, and a noncharged polar residue (N, Q, T, S) composition of about <em>2</em>0% or less. Results on four de novo designed, 33-residue peptides are presented supporting this approach. Under near physiologic conditions, all four peptides are soluble, form beta-sheet structures to varying degrees, and self-associate. One peptide folds as a stable, compact beta-sheet tetramer, whereas the others are transient beta-sheet-containing aggregates.

The recombinant humanized antibody (rhuMAb) VEGF has a high affinity for vascular endothelial growth factor and is currently being evaluated in clinical trials as a cancer therapeutic. Under acidic pH and low ionic strength conditions, the antibody was predominantly present as monomer. Under physiological conditions, the appearance of significant amounts of a noncovalent, reversible <em>dimer</em> were observed by size-exclusion chromatography. The kinetics and thermodynamics of the reversible self-association for rhuMAb VEGF monomer were investigated as a function of pH, temperature, and ionic strength by size-exclusion chromatography using the concentration jump method. The rate constant for <em>dimer</em> formation ranged <em>2</em>3-11<em>2</em> M(-)(1) min(-)(1) under the conditions studied, values that are significantly lower than those reported in the literature for other proteins that self-associate. The rate constant for dissociation ranged 0.0039-0.0<em>2</em>1 min(-)(1). Gibbs' free energies, enthalpies, entropies, and activation energies were determined and revealed that <em>dimer</em> formation is optimal at pH 7.5-8.0, which may be reflective of charge shielding occurring near the pI of the protein. There was a negative change in entropy for dissociation (values from -18.1 to -1<em>2</em>.8 cal/mol K). In the presence of <em>D</em>(<em>2</em>)O or 1 M NaCl, <em>dimer</em>ization was enhanced. The results of the kinetic and thermodynamic analysis of this study indicate that rhuMAb VEGF <em>dimer</em>ization occurs primarily through hydrophobic interactions.

OBJECTIVE

Several prospective studies have shown significant associations between plasma fibrinogen, viscosity, C-reactive protein (CRP), fibrin D-dimer, or tissue plasminogen activator (tPA) antigen and the risk of primary cardiovascular events. Little has been published on the associations of these variables with recurrent stroke. We studied such associations in a nested case-control study derived from the Perindopril Protection Against Recurrent Stroke Study (PROGRESS).

METHODS

Nested case-control study of ischemic (n=472) and hemorrhagic (n=83) strokes occurring during a randomized, placebo-controlled multicenter trial of perindopril-based therapy in 6105 patients with a history of stroke or transient ischemic attack. Controls were matched for age, treatment group, sex, region, and most recent qualifying event at entry to the parent trial.

RESULTS

Fibrinogen and CRP were associated with an increased risk of recurrent ischemic stroke after accounting for the matching variables and adjusting for systolic blood pressure, smoking, peripheral vascular disease, and statin and antiplatelet therapy. The odds ratio for the last compared with the first third of fibrinogen was 1.34 (95% CI, 1.01 to 1.78) and for CRP was 1.39 (95% CI, 1.05 to 1.85). After additional adjustment for each other, these 2 odds ratios stayed virtually unchanged. Plasma viscosity, tPA, and d-dimer showed no relationship with recurrent ischemic stroke, although tPA was significant for lacunar and large artery subtypes. Although each of these variables showed a negative relationship with recurrent hemorrhagic stroke, none of these relationships achieved statistical significance.

CONCLUSIONS

Fibrinogen and CRP are risk predictors for ischemic but not hemorrhagic stroke, independent of potential confounders.

Kinetic parameters of T cell receptor (TCR) interactions with its ligan<em>d</em> have been propose<em>d</em> to control T cell activation. Analysis of kinetic <em>d</em>ata obtaine<em>d</em> has so far pro<em>d</em>uce<em>d</em> conflicting insights; here, we offer a consi<em>d</em>eration of this problem. As a mo<em>d</em>el system, association an<em>d</em> <em>d</em>issociation of a soluble TCR (sT1) an<em>d</em> its specific ligan<em>d</em>, an azi<em>d</em>obenzoic aci<em>d</em> <em>d</em>erivative of the pepti<em>d</em>e SYIPSAEK-(ABA)I (resi<em>d</em>ues <em>2</em>5<em>2</em>-<em>2</em>60 from Plasmo<em>d</em>ium berghei circumsporozoite protein), boun<em>d</em> to class I MHC H-<em>2</em>K(<em>d</em>)-enco<em>d</em>e<em>d</em> molecule (MHCp) were stu<em>d</em>ie<em>d</em> by surface plasmon resonance. The association time courses exhibite<em>d</em> biphasic patterns. The fast an<em>d</em> <em>d</em>ominant phase was assigne<em>d</em> to ligan<em>d</em> association with the major fraction of TCR molecules, whereas the slow component was attribute<em>d</em> to the presence of traces of TCR <em>dimers</em>. The association rate constant <em>d</em>erive<em>d</em> for the fast phase, assuming a reversible, single-step reaction mechanism, was relatively slow an<em>d</em> marke<em>d</em>ly temperature-<em>d</em>epen<em>d</em>ent, <em>d</em>ecreasing from 7.0 x 10(3) at <em>2</em>5 <em>d</em>egrees C to 1.8 x 10(<em>2</em>) M(-1).s(-1) at 4 <em>d</em>egrees C. Hence, it is suggeste<em>d</em> that these observe<em>d</em> slow rate constants are the result of unresolve<em>d</em> elementary steps of the process. In<em>d</em>ee<em>d</em>, our analysis of the kinetic <em>d</em>ata shows that the time courses of TCR-MHCp interaction fit well to two <em>d</em>ifferent, yet closely relate<em>d</em> mechanisms, where an in<em>d</em>uce<em>d</em> fit or a preequilibrium of two unboun<em>d</em> TCR conformers are operational. These mechanisms may provi<em>d</em>e a rationale for the reporte<em>d</em> conformational flexibility of the TCR an<em>d</em> its unusual ligan<em>d</em> recognition properties, which combine high specificity with consi<em>d</em>erable crossreactivity.

Rev is an essential regulatory HIV-1 protein that binds the Rev responsive element (RRE) within the env gene of the HIV-1 RNA genome, activating the switch between viral latency and active viral replication. Previously, we have shown that selective incorporation of the fluorescent probe <em>2</em>-aminopurine (<em>2</em>-AP) into a truncated form of the RRE sequence (RRE-IIB) allowed the binding of an arginine-rich peptide derived from Rev and aminoglycosides to be characterized directly by fluorescence methods. Using these fluorescence and nuclear magnetic resonance (NMR) methods, proflavine has been identified, through a limited screen of selected small heterocyclic compounds, as a specific and high-affinity RRE-IIB binder which inhibits the interaction of the Rev peptide with RRE-IIB. <em>D</em>irect and competitive <em>2</em>-AP fluorescence binding assays reveal that there are at least two classes of proflavine binding sites on RRE-IIB: a high-affinity site that competes with the Rev peptide for binding to RRE-IIB (K(<em>D</em>) approximately 0.1 +/- 0.05 microM) and a weaker binding site(s) (K(<em>D</em>) approximately 1.1 +/- 0.05 microM). Titrations of RRE-IIB with proflavine, monitored using (1)H NMR, demonstrate that the high-affinity proflavine binding interaction occurs with a <em>2</em>:1 (proflavine:RRE-IIB) stoichiometry, and NOEs observed in the NOESY spectrum of the <em>2</em>:1 proflavine.RRE-IIB complex indicate that the two proflavine molecules bind specifically and close to each other within a single binding site. NOESY data further indicate that formation of the <em>2</em>:1 proflavine.RRE-IIB complex stabilizes base pairing and stacking within the internal purine-rich bulge of RRE-IIB in a manner analogous to what has been observed in the Rev peptide.RRE-IIB complex. The observation that proflavine competes with Rev for binding to RRE-IIB by binding as a <em>dimer</em> to a single high-affinity site opens the possibility for rational drug design based on linking and modifying it and related compounds.

A technique was investigated for the direct visualization on paraffin sections of galactose and N-acetylgalactosamine residues terminating saccharide chains in complex carbohydrates. Sections were incubated with the enzyme galactose oxidase (GO), which oxidizes the C-6 hydroxyl of galactose or N-acetylgalactosamine (GalNAc) residues, and the resulting aldehyde was visualized by its reaction with Schiff's reagent. Submaxillary and sublingual glands, pancreas, stomach, duodenum, and ileum from mice and rats were stained with the GO-Schiff sequence and results were compared with staining by a peanut lectin-horseradish peroxidase (PL-HRP) conjugate that binds selectively to terminal galactose and preferentially to the terminal <em>dimer</em> beta-<em>D</em>-Gal-(1 leads to 3)-<em>D</em>-GalNAc. Three classes of reactive sites were revealed: 1) those reactive with both GO-Schiff and PL-HRP, <em>2</em>) those stained with the GO-Schiff sequence but unreactive with PL-HRP, and 3) those GO-Schiff unreactive but PL-HRP positive. Based on the carbohydrate binding specificity of GO and PL, it is suggested that tissue complex carbohydrates in group one contain terminal beta-galactose residues with unmodified hydroxyls at C-<em>2</em>, C-4, and C-6, whereas those in group two contain terminal GalNAc residues. The structure of oligosaccharides in group 3 sites remains enigmatic.

Transcription factor p63, a p53 family member, plays a role in epithelial cell <em>d</em>evelopment, cell cycle arrest, apoptosis, an<em>d</em> tumorigenesis. Point mutations, primarily in the DNA bin<em>d</em>ing <em>d</em>omain (p63DBD), lea<em>d</em> to malformation syn<em>d</em>romes. To gain insight into <em>d</em>ifferences between p63 an<em>d</em> p53 an<em>d</em> the impact of mutations on the structure, we have <em>d</em>etermine<em>d</em> two crystal structures of p63DBD in complex with A/T-rich response elements. One complex contains a 10-bp DNA half-site response element (5'AAACATGTTT3') an<em>d</em> the other contains a <em>2</em><em>2</em>-bp DNA full response element with a <em>2</em>-bp spacer between two half-sites (5'AAACATGTTTTAAAACATGTTT3'). In both structures, each half-site bin<em>d</em>s a p63DBD <em>dimer</em>. The two p63DBD <em>dimers</em> <em>d</em>o not interact in the presence of the DNA spacer, whereas they interact with one another in the p63DBD/10-bp complex where the DNA simulates a full response element by packing en<em>d</em>-to-en<em>d</em>. A unique <em>dimer</em>-<em>dimer</em> interaction involves a variable loop region, which <em>d</em>iffers in length an<em>d</em> sequence from the counterpart loop of p53DBD. The DNA trajectories in both structures assume superhelical conformations. Surface plasmon resonance stu<em>d</em>ies of p63DBD/DNA bin<em>d</em>ing yiel<em>d</em>e<em>d</em> K(<em>d</em>) = 11.7 μM for a continuous full response element, whereas bin<em>d</em>ing was un<em>d</em>etectable with the <em>2</em><em>2</em>-bp DNA, suggesting an important contribution of a p63DBD inter<em>dimer</em> interface to bin<em>d</em>ing an<em>d</em> establishing that p63DBD affinity to the response element is approximately 1,000-fol<em>d</em> lower than that of p53DBD. Analyses of the structural consequences of p63DBD mutations that cause <em>d</em>evelopmental <em>d</em>efects show that, although some mutations affect DNA bin<em>d</em>ing <em>d</em>irectly, the majority affects protein stability.

X-ray crystallographic stu<em>d</em>ies of the N-terminal <em>d</em>omain of Hsp90 have i<em>d</em>entifie<em>d</em> an unconventional ATP bin<em>d</em>ing fol<em>d</em>, thereby inferring a role for ATP in the regulation of the Hsp90 activity. In this report, N-ethylcarboxami<em>d</em>oa<em>d</em>enosine (NECA) was use<em>d</em> to investigate the nucleoti<em>d</em>e bin<em>d</em>ing properties of GRP94, the en<em>d</em>oplasmic reticulum paralog of Hsp90. Whereas Hsp90 <em>d</em>i<em>d</em> not bin<em>d</em> NECA, GRP94 boun<em>d</em> NECA in a saturable manner with a K(<em>d</em>) of <em>2</em>00 nm. NECA bin<em>d</em>ing to GRP94 was efficiently blocke<em>d</em> by gel<em>d</em>anamycin an<em>d</em> ra<em>d</em>icicol. Analysis of ligan<em>d</em> bin<em>d</em>ing stoichiometries by ra<em>d</em>ioligan<em>d</em> an<em>d</em> calorimetric techniques in<em>d</em>icate<em>d</em> that GRP94 boun<em>d</em> 1 mol of NECA/mol of GRP94 <em>dimer</em>. In contrast, GRP94 boun<em>d</em> ra<em>d</em>icicol at a stoichiometry of <em>2</em> mol of ra<em>d</em>icicol/mol of GRP94 <em>dimer</em>. In [(3)H]NECA <em>d</em>isplacement assays, GRP94 <em>d</em>isplaye<em>d</em> bin<em>d</em>ing interactions with ATP, <em>d</em>ATP, ADP, AMP, cAMP, an<em>d</em> a<em>d</em>enosine, but not GTP, CTP, or UTP. To accommo<em>d</em>ate the 0.5 mol of NECA:mol of GRP94 bin<em>d</em>ing stoichiometry observe<em>d</em> for the native GRP94 <em>dimer</em>, a mo<em>d</em>el for allosteric regulation (negative cooperativity) of ligan<em>d</em> bin<em>d</em>ing is propose<em>d</em>. A hypothesis on the regulation of GRP94 conformation an<em>d</em> activity by a<em>d</em>enosine-base<em>d</em> ligan<em>d</em>(s) other than ATP an<em>d</em> ADP is presente<em>d</em>.

OBJECTIVE

To establish the plasma evolution of prothrombin fragments 1+<em>2</em> (F 1+<em>2</em>), thrombin-antithrombin III complexes (TAT), fibrin fragment <em>D</em>-<em>Dimers</em> (<em>D</em><em>D</em>), von Willebrand factor antigen (vWf), Type 1 plasminogen activator inhibitor antigen (PAI) and blood platelet count during normal pregnancy and to compare these values with those obtained in hypertensive or pre-eclamptic pregnancies.

METHODS

Cross-sectional study.

METHODS

Forty-seven healthy pregnant women with gestational age ranging between 5 and 40 weeks, and fourteen women with gestational age ranging between <em>2</em>5 and 38 weeks presenting with either gestational hypertension (n = 4) or pre-eclampsia (n = 10). Numbers of nulliparous women in the control, hypertension and pre-eclampsia groups were 13/47 (<em>2</em>8%), 1/4 (<em>2</em>5%) and 9/10 (90%), respectively.

RESULTS

All six markers increased with gestational age in normal pregnant women (P < 0.01). Using the upper limit of 95% prediction interval obtained from regression curves as normality threshold, TAT showed the best sensitivity (71% vs < 30% for F1+<em>2</em>, <em>D</em><em>D</em>, vWf, PAI and platelet count).

CONCLUSIONS

TAT appears to be an interesting marker for detecting haemostatic system alterations in pregnancies complicated by hypertension or pre-eclampsia. A large prospective study to determine its clinical usefulness for such complicated pregnancies is currently in progress.

The Fur protein represses transcription of iron-responsive genes in bacteria. The <em>d</em>iscovery that Fur is a zinc metalloprotein an<em>d</em> the use of surrogate metals for Fe(<em>2</em>+) for in vitro stu<em>d</em>ies question whether Fur is a <em>d</em>irect iron sensor. In the present stu<em>d</em>y, we show that the affinity of Fur from Bra<em>d</em>yrhizobium japonicum (BjFur) for its target DNA increases 30-fol<em>d</em> in the presence of metal, with a K(<em>d</em>) value of about <em>2</em> nM. DNase I footprinting experiments showe<em>d</em> that BjFur protecte<em>d</em> its bin<em>d</em>ing site within the irr gene promoter in the presence of Fe(<em>2</em>+) but not in the absence of metal, showing that DNA bin<em>d</em>ing is Fe(<em>2</em>+)-<em>d</em>epen<em>d</em>ent. BjFur <em>d</em>i<em>d</em> not inhibit in vitro transcription from the irr promoter using purifie<em>d</em> components in the absence of metal, but BjFur represse<em>d</em> transcription in the presence of Fe(<em>2</em>+). Thus, BjFur is an iron-responsive transcriptional repressor in vitro. A regulatory Fe(<em>2</em>+)-bin<em>d</em>ing site (site 1) an<em>d</em> a structural Zn(<em>2</em>+)-bin<em>d</em>ing site (site <em>2</em>) inferre<em>d</em> from the recent crystal structure of Fur from Pseu<em>d</em>omonas aeruginosa are compose<em>d</em> of amino aci<em>d</em>s highly conserve<em>d</em> in many Fur proteins, inclu<em>d</em>ing BjFur. BjFur mutants containing substitutions in site 1 (BjFurS1) or site <em>2</em> (BjFurS<em>2</em>) boun<em>d</em> DNA with high affinity an<em>d</em> represse<em>d</em> transcription in vitro in an Fe(<em>2</em>+)-<em>d</em>epen<em>d</em>ent manner. Interestingly, only a single <em>dimer</em> of BjFurS<em>2</em> occupie<em>d</em> the irr promoter, whereas the wil<em>d</em> type an<em>d</em> BjFurS1 <em>d</em>isplaye<em>d</em> one- or two-<em>dimer</em> occupancy. We suggest that the putative functions for metal-bin<em>d</em>ing sites <em>d</em>e<em>d</em>uce<em>d</em> from the structure of P. aeruginosa Fur cannot be extrapolate<em>d</em> to bacterial Fur proteins as a whole.

We have synthesize<em>d</em> an<em>d</em> characterize<em>d</em> bis(mu-oxo)<em>d</em>icopper(III) <em>dimers</em> 1b-4b (Os) base<em>d</em> on a core family of peralkylate<em>d</em> trans-(1R,<em>2</em>R)-cyclohexane<em>d</em>iamine (CD) ligan<em>d</em>s, self-assemble<em>d</em> from the correspon<em>d</em>ing [LCu(MeCN)]CF3SO3 species 1a-4a an<em>d</em> O<em>2</em> at 193 K in aprotic me<em>d</em>ia; a<em>d</em><em>d</em>itional Os base<em>d</em> on peralkylate<em>d</em> ethylene<em>d</em>iamine an<em>d</em> tri<em>d</em>entate polyazacyclononane ligan<em>d</em>s were synthesize<em>d</em> analogously for comparative purposes (5b-7b an<em>d</em> 8b-9b, respectively). Trigonal-planar [LCu(MeCN)]1+ species are propose<em>d</em> as the active O precursors. The 3-coor<em>d</em>inate Cu(I) complexes [(L(TE))Cu(MeCN)]CF3SO3 (4a) an<em>d</em> [(L(TB))Cu(MeCN)]CF3SO3 (10a) were structurally characterize<em>d</em>; the apparent O<em>2</em>-inertness of 10a correlates with the steric <em>d</em>eman<em>d</em>s of its four benzyl substituents. The rate of O formation, a multistep process that likely procee<em>d</em>s via associative formation of a 1:1 [LCu(O<em>2</em>)]1+ interme<em>d</em>iate, exhibits significant <em>d</em>epen<em>d</em>ence upon ligan<em>d</em> sterics an<em>d</em> solvent: oxygenation of 4a-the slowest-reacting O precursor of the CD series-is first-or<em>d</em>er with respect to [4a] an<em>d</em> procee<em>d</em>s at least 300 times faster in tetrahy<em>d</em>rofuran than in CH<em>2</em>Cl<em>2</em>. The EPR, UV-vis, an<em>d</em> resonance Raman spectra of 1b-9b are all characteristic of the <em>d</em>iamagnetic bis(mu-oxo)<em>d</em>icopper(III) core. The intense ligan<em>d</em>-to-metal charge transfer absorption maxima of CD-base<em>d</em> Os are re<em>d</em>-shifte<em>d</em> proportionally with increasing peripheral ligan<em>d</em> bulk, an effect ascribe<em>d</em> to a slight <em>d</em>istortion of the [Cu<em>2</em>O<em>2</em>] rhomb. The well-or<em>d</em>ere<em>d</em> crystal structure of [(L(ME))<em>2</em>Cu<em>2</em>(mu-O)<em>2</em>](CF3SO3)<em>2</em>.4CH<em>2</em>Cl<em>2</em> ([3b. 4CH<em>2</em>Cl<em>2</em>]) features the most metrically compact [Cu<em>2</em>O<em>2</em>]<em>2</em>+ core among structurally characterize<em>d</em> Os (av Cu-O 1.80<em>2</em>(7) A; Cu...Cu <em>2</em>.744(1) A) an<em>d</em> exemplifies the minimal square-planar ligation environment necessary for stabilization of Cu(III). The reporte<em>d</em> Os are mil<em>d</em> oxi<em>d</em>ants with mo<em>d</em>erate reactivity towar<em>d</em> coor<em>d</em>inating substrates, rea<em>d</em>ily oxi<em>d</em>izing thiols, certain activate<em>d</em> alkoxi<em>d</em>es, an<em>d</em> electron-rich phenols in a net <em>2</em>e-, <em>2</em>H+ process. In the absence of substrates, 1b-9b un<em>d</em>ergo thermally in<em>d</em>uce<em>d</em> autolysis with concomitant <em>d</em>egra<em>d</em>ation of the polyamine ligan<em>d</em>s. Ligan<em>d</em> pro<em>d</em>uct <em>d</em>istribution an<em>d</em> primary kinetic isotope effects (kobsH/kobsD approximately 8, 1b/<em>d</em><em>2</em>4-1b, <em>2</em>93 K) support a unimolecular mechanism involving rate-<em>d</em>etermining C-H bon<em>d</em> cleavage at accessible ligan<em>d</em> N-alkyl substituents. Decomposition half-lives span almost 3 or<em>d</em>ers of magnitu<em>d</em>e at <em>2</em>93 K, ranging from approximately <em>2</em> s for 4b to almost 30 min for <em>d</em>(<em>2</em>4)-1b, the most thermally robust <em>d</em>icationic O yet reporte<em>d</em>. Dealkylation is highly selective where ligan<em>d</em> rigi<em>d</em>ity constrains accessibility; in 3b, the ethyl groups are attacke<em>d</em> preferentially. The observe<em>d</em> relative thermal stabilities an<em>d</em> <em>d</em>ealkylation selectivities of 1b-9b are correlate<em>d</em> with NC(alpha)-H bon<em>d</em> <em>d</em>issociation energies, statistical factors, ligan<em>d</em> backbone rigi<em>d</em>ity, an<em>d</em> ligan<em>d</em> <em>d</em>enticity/axial <em>d</em>onor strength. Among the peralkylate<em>d</em> amines surveye<em>d</em>, bi<em>d</em>entate ligan<em>d</em>s with oxi<em>d</em>atively robust NC(alpha)-H bon<em>d</em>s provi<em>d</em>e optimal stabilization for Os. Fortuitously, the least sterically <em>d</em>eman<em>d</em>ing N-alkyl substituent (methyl) gives rise to the most thermally stable an<em>d</em> most physically accessible O core, retaining the potential for exogenous substrate reactivity.

The homogeneous self-association of isolated alphaSH chains and betaSH chains from human hemoglobin has been studied by analytical molecular sieve chromatography over the concentration range 0.004 to 15.<em>2</em> mg/ml. Detailed studies were carried out as a function of temperature at pH 7.4 in 0.1 M Tris/HCl, 0.1 M NaCl, 1 mM Na<em>2</em>EDTA in order to establish stoichiometries, equilibrium constants, and enthalpies for the self-association reactions. The dissociation data best describe the alphaSH system as being a monomer-<em>dimer</em> equilibrium (<em>2</em>alpha1 in equilibrium alpha<em>2</em>). Under the same conditions the betaSH system is best described by a monomer-tetramer equilibrium (4beta1 in equilibrium beta4). van't Hoff enthalpies were determined from the temperature dependence of the equilibrium constants. For the <em>2</em>alpha in equilibrium alpha<em>2</em> reaction the molar enthalpy <em>delta</em> H = 4.3 +/- 0.5 kcal, and for the reaction 4beta1 in equilibrium beta4, <em>delta</em>H = <em>2</em>3.5 +/- 1.0 kcal. Unitary entropies were determined to be: <em>delta</em>Su = 40.6 e.u., <em>delta</em>Su = 177.5 e.u., respectively. Thermodynamic parameters for association of the two types of chains are roughly comparable in magnitude if four bonding interactions are assumed in the beta4 tetramer. Both reactions are entropy-driven, and the overall results (including salt effects) are consistent with a dominant role of hydrophobic interactions. Increasing the NaCl concentration to <em>2</em> M at <em>2</em>1.5 degrees under the same buffer conditions increases the association constant for both the alphaSH and betatsh chains. This increase in the association constants with increasing salt concentration is attributable to the increased binding of salt, or the release of bound water upon formation of the association complexes, or both. The present results do not distinguish between these possibilities. The introduction of inositol hexaphosphate (IHP) was found to have no effect upon subunit association in betaSH chains. This result and the previously observed effect of IHP upon oxygenation of beta chains imply that oxygenation and self-association are completely unlinked in this system. Accurate determinations of (a) the enthalpy changes for homogeneous reactions of isolated chains, carried out in this study and of (b) the enthalpy of forming alpha<em>2</em>beta<em>2</em> tetramers from alphabeta <em>dimers</em> provide a basis for the interpretation of (c) calorimetric studies on reconstitution of hemoglobin from the isolated chains, described in accompanying papers.

We have used NMR spectroscopy to determine the three-dimensional (3<em>D</em>) structure, and to characterize the backbone dynamics, of a recombinant version of bovine beta-lactoglobulin (variant A) at pH <em>2</em>. 6, where the protein is a monomer. The structure of this low-pH form of beta-lactoglobulin is very similar to that of a subunit within the <em>dimer</em> at pH 6.<em>2</em>. The root-mean-square deviation from the pH 6.<em>2</em> (crystal) structure, calculated for backbone atoms of residues 6-160, is approximately 1.3 A. <em>D</em>ifferences arise from the orientation, with respect to the calyx, of the A-B and C-<em>D</em> loops, and of the flanking three-turn alpha-helix. The hydrophobic cavity within the calyx is retained at low pH. The E-F loop (residues 85-90), which moves to occlude the opening of the cavity over the pH range 7.<em>2</em>-6.<em>2</em>, is in the "closed" position at pH <em>2</em>.6, and the side chain of Glu89 is buried. We also carried out measurements of (15)N T(1)s and T(<em>2</em>)s and (1)H-(15)N heteronuclear NOEs at pH <em>2</em>.6 and 37 degrees C. Although the residues of the E-F loop (residues 86-89) have the highest crystallographic B-factors, the conformation of this loop is reasonably well defined by the NMR data, and its backbone is not especially mobile on the pico- to nanosecond time scale. Several residues (Ser<em>2</em>1, Lys60, Ala67, Leu87, and Glu11<em>2</em>) exhibit large ratios of T(1) to T(<em>2</em>), consistent with conformational exchange on a micro- to millisecond time scale. The positions of these residues in the 3<em>D</em> structure of beta-lactoglobulin are consistent with a role in modulating access to the hydrophobic cavity.