The FraxiProtec, an autodissemination device loaded with the fungus Beauveria bassiana isolate CFL-A, was tested in the field to evaluate its potential to infect emerald ash borer adults and reduce their populations. During the 2-yr experimental period, the dispersion of B. bassiana-infected adults was also documented to assess the dissemination capacity of the biocontrol agent beyond the treated areas. The mean percentage of infected emerald ash borer in 2017 and 2018 in 15 treated sites was 43.3 ± 2.9% and 39.7 ± 3.9%, respectively, and no significant variation was observed over the tested years. Furthermore, a 40% significant reduction of the mean emerald ash borer population growth per tree in treated sites was recorded when compared to the control sites. Emerald ash borer infected with B. bassiana isolate CFL-A were collected from baited sticky traps in the sentinel stations in the area surrounding the FraxiProtec-treated sites. Even at a distance of 125 m, an average of 9.4 ± 2.6% infected emerald ash borer were collected. Finally, exploratory analyzes were carried out on parameters such as the area to be treated, ash tree density, and FraxiProtec density to document potential relationships, which could be used in the determination of a prescription.

Keywords: Agrilus planipennis; Beauveria bassiana; FraxiProtec; biological control; emerald ash borer.

BACKGROUND

Compact fluorescent lamps (CFLs) have been heralded as highly energy efficient replacements for incandescent light globes, however, there is some public dissatisfaction with the light output and colour of CFLs. Independent examination of the claims made has not been made. Compliance with the interim Australian/New Zealand Standard has not been established by any independent authority. While the total light output (luminous flux) may meet certain standards, luminous intensity distributions of some designs do differ significantly from the incandescent sources that they are intended to replace.

METHODS

Luminous intensity distribution, luminous flux and spectral energy distribution of CFLs claimed to be equivalent to 75 W incandescent globes and 75 W incandescent globes (pearl and clear) were measured. Luminous flux, luminous efficacy, colour rendering index, correlated colour temperature, wattage and power factor were then calculated and compared with claims made by manufacturers and requirements of the standards.

RESULTS

The sources generally complied with the requirements for luminous flux, luminous efficacy, colour rendering index and correlated colour temperature. The claim of 75 W equivalence, which is not regulated in Australia and New Zealand, is justified less than half the time. Luminous intensity distributions of biaxial CFLs are distinctly different from the incandescent lamps they purport to replace.

CONCLUSIONS

CFLs generally comply with the standards set. The basis on which equivalent wattages are claimed needs to be included in the Australian and New Zealand standard because this is the measure most likely to be relied on by the public. Due to the differences in luminous intensity distribution, CFLs may not necessarily be a direct replacement for incandescent sources without some consideration.

OBJECTIVE

To improve recognition of thyroid carcinoma in rapid consultation on Diff-Quik-stained (Fisher Diagnostics, Middletown, Virginia, USA.) fine-needle aspiration (FNA) and rapid hematoxylin-eosin (H-E)-stained intraoperative scrape preparation (ISP) specimens by assessing 3 variables (anisokaryosis, nuclear overlap [NO] and scant/absent colloid) in cases of cellular follicular lesions (CFL), an indeterminate diagnostic category.

METHODS

Thirty-seven FNAs and 28 ISPs diagnosed as CFL, with histologic follow-up, were evaluated in blinded fashion by 3 cytopathologists assessing the 3 variables.

RESULTS

Over 90% of the malignant cases showed NO in both FNA and ISP, while only 22% of the benign cases did; positive and negative predictive values (PPV and NPV) were 82% and 100%. All malignant cases showed significant anisokaryosis in both FNA and ISP in contrast to 24% of benign cases; PPV and NPV were 74% and 100%. Scant/absent colloid was seen in 87% and 39% of malignancies in FNA and ISP, respectively, as compared to 55% and 20% of the benign cases. PPV and NPV were 52% and 83% in FNA and 63% and 60% in ISP, respectively.

CONCLUSIONS

Application of these variables improves recognition of thyroid carcinoma, particularly in fine needle aspirates, while additional material may be requested. With ISP, their absence supports recommending against further surgery. Together, optimal surgical planning and outcome may be obtained.

We report on a new pitch reduction lithographic technique by utilizing pressure-assisted selective wetting and thermal reflow. The primary line-and-space pattern of low molecular weight polystyrene (PS) (Mw=17,300) was formed by solvent-assisted capillary force lithography (CFL), on which a diluted photoresist (PR) solution was selectively filled into the spaces by the application of a slight pressure (200 g cm(-2)). Subsequent removal of the PS pattern by toluene and ashing process led to a line pattern with approximately 50% pitch reduction. It was observed that the size reduction and space to width ratios were controllable by changing PR concentration and ashing time.

Gas embolisms can hinder blood flow and lead to occlusion of the vessels and ischemia. Bubbles in microvessels circulate as tubular bubbles (Taylor bubbles) and can be trapped, blocking the normal flow of blood. To understand how Taylor bubbles flow in microcirculation, in particular, how bubbles disturb the blood flow at the scale of blood cells, experiments were performed in microchannels at a low Capillary number. Bubbles moving with a stream of in vitro blood were filmed with the help of a high-speed camera. Cell-free layers (CFLs) were observed downstream of the bubble, near the microchannel walls and along the centerline, and their thicknesses were quantified. Upstream to the bubble, the cell concentration is higher and CFLs are less clear. While just upstream of the bubble the maximum RBC concentration happens at positions closest to the wall, downstream the maximum is in an intermediate region between the centerline and the wall. Bubbles within microchannels promote complex spatio-temporal variations of the CFL thickness along the microchannel with significant relevance for local rheology and transport processes. The phenomenon is explained by the flow pattern characteristic of low Capillary number flows. Spatio-temporal variations of blood rheology may have an important role in bubble trapping and dislodging.

Background: We examined influences of conditioned media from chondrocytes (Ch) on juvenile idiopathic arthritis synovial fibroblasts (JFLS) and potential for JFLS to undergo endochondral bone formation (EBF).

Methods: Primary cells from three control fibroblast-like synoviocytes (CFLS) and three JFLS were cultured in Ch-conditioned media and compared with untreated fibroblast-like synoviocytes (FLS). RNA was analyzed by ClariomS microarray. FLS cells cultured in conditioned media were exposed to either TGFBR1 inhibitor LY3200882 or exogenous BMP4 and compared with FLS cultured in conditioned media from Ch (JFLS-Ch). Media supernatants were analyzed by ELISA.

Results: In culture, JFLS downregulate BMP2 and its receptor BMPR1a while upregulating BMP antagonists (NOG and CHRD) and express genes (MMP9, PCNA, MMP12) and proteins (COL2, COLX, COMP) associated with chondrocytes. Important TGFβ superfamily member gene expression (TGFBI, MMP9, COL1A1, SOX6, and MMP2) is downregulated when JFLS are cultured in Ch-conditioned media. COL2, COLX and COMP protein expression decreases in JFLS-Ch. BMP antagonist protein (NOG, CHRD, GREM, and FST) secretion is significantly increased in JFLS-Ch. Protein phosphorylation increases in JFLS-Ch exposed to exogenous BMP4, and chondrocyte-like phenotype is restored in BMP4 presence, evidenced by increased secretion of COL2 and COLX. Inhibition of TGFBR1 in JFLS-Ch results in overexpression of COL2.

Conclusions: JFLS are chondrocyte-like, and Ch-conditioned media can abrogate this phenotype. The addition of exogenous BMP4 causes JFLS-Ch to restore this chondrocyte-like phenotype, suggesting that JFLS create a microenvironment favorable for endochondral bone formation, thereby contributing to joint growth disturbances in juvenile idiopathic arthritis.

Keywords: BMP antagonists; BMP4; Chondrocyte; Endochondral bone formation; Fibroblast; Growth disturbances; Hypertrophy; Juvenile idiopathic arthritis; Synoviocyte; TGFβ.

In this paper, we present a novel pressure-based semi-implicit finite volume solver for the equations of compressible ideal, viscous, and resistive magnetohydrodynamics (MHD). The new method is conservative for mass, momentum, and total energy, and in multiple space dimensions, it is constructed in such a way as to respect the divergence-free condition of the magnetic field exactly, also in the presence of resistive effects. This is possible via the use of multidimensional Riemann solvers on an appropriately staggered grid for the time evolution of the magnetic field and a double curl formulation of the resistive terms. The new semi-implicit method for the MHD equations proposed here discretizes the nonlinear convective terms as well as the time evolution of the magnetic field explicitly, whereas all terms related to the pressure in the momentum equation and the total energy equation are discretized implicitly, making again use of a properly staggered grid for pressure and velocity. Inserting the discrete momentum equation into the discrete energy equation then yields a mildly nonlinear symmetric and positive definite algebraic system for the pressure as the only unknown, which can be efficiently solved with the (nested) Newton method of Casulli et al. The pressure system becomes linear when the specific internal energy is a linear function of the pressure. The time step of the scheme is restricted by a CFL condition based only on the fluid velocity and the Alfvén wave speed and is not based on the speed of the magnetosonic waves. Being a semi-implicit pressure-based scheme, our new method is therefore particularly well suited for low Mach number flows and for the incompressible limit of the MHD equations, for which it is well known that explicit density-based Godunov-type finite volume solvers become increasingly inefficient and inaccurate because of the more and more stringent CFL condition and the wrong scaling of the numerical viscosity in the incompressible limit. We show a relevant MHD test problem in the low Mach number regime where the new semi-implicit algorithm is a factor of 50 faster than a traditional explicit finite volume method, which is a very significant gain in terms of computational efficiency. However, our numerical results confirm that our new method performs well also for classical MHD test cases with strong shocks. In this sense, our new scheme is a true all Mach number flow solver.

A total of 362 stool specimens were collected from 184 and 178 patients presenting at the Buea district Hospital with and without diarrhoea, respectively. The samples were screened and cultured for Candida albicans using standard microbiological procedures. Of the 184 diarrhoeic stool cultures, 35.9% showed C. albicans overgrowth as indicated by count>>or=10(4) CFL/mL. Of the 178 non diarrhoeic stool cultures, C. albicans was identified in 23.6% of samples and counts were all <10(4) CFU/mL. An association was observed for C. albicans overgrowth and diarrhoea (p<0.001). The majority of isolates (87.8%) from the 66 samples showing candida overgrowth were susceptible to Amphotericin B in anti-fungal drug sensitivity assays. Results of the study highly suggest that C. albicans is an important cause of diarrhoea in the study area. We recommend that this fungus should be routinely checked in individuals presenting with diarrhoea particularly children and patients on prolonged or frequent antibiotic therapy.

We investigated the influence of light quality on the vulnerability of pepper plants to water deficit. For this purpose plants were cultivated either under compact fluorescence lamps (CFL) or light-emitting diodes (LED) providing similar photon fluence rates (95 µmol m(-2) s(-1)) but distinct light quality. CFL emit a wide-band spectrum with dominant peaks in the green and red spectral region, whereas LEDs offer narrow band spectra with dominant peaks at blue (445 nm) and red (665 nm) regions. After one-week acclimation to light conditions plants were exposed to water deficit by withholding irrigation; this period was followed by a one-week regeneration period and a second water deficit cycle. In general, plants grown under CFL suffered more from water deficit than plants grown under LED modules, as indicated by the impairment of the photosynthetic efficiency of PSII, resulting in less biomass accumulation compared to respective control plants. As affected by water shortage, plants grown under CFL had a stronger decrease in the electron transport rate (ETR) and more pronounced increase in heat dissipation (NPQ). The higher amount of blue light suppressed plant growth and biomass formation, and consequently reduced the water demand of plants grown under LEDs. Moreover, pepper plants exposed to high blue light underwent adjustments at chloroplast level (e.g., higher Chl a/Chl b ratio), increasing the photosynthetic performance under the LED spectrum. Differently than expected, stomatal conductance was comparable for water-deficit and control plants in both light conditions during the stress and recovery phases, indicating only minor adjustments at the stomatal level. Our results highlight the potential of the target-use of light quality to induce structural and functional acclimations improving plant performance under stress situations.

Based on available literature, ecology and economy of light emitting diode (LED) lights in plant foods production were assessed and compared to high pressure sodium (HPS) and compact fluorescent light (CFL) lamps. The assessment summarises that LEDs are superior compared to other lamp types. LEDs are ideal in luminous efficiency, life span and electricity usage. Mercury, carbon dioxide and heat emissions are also lowest in comparison to HPS and CFL lamps. This indicates that LEDs are indeed economic and eco-friendly lighting devices. The present review indicates also that LEDs have many practical benefits compared to other lamp types. In addition, they are applicable in many purposes in plant foods production. The main focus of the review is the targeted use of LEDs in order to enrich phytochemicals in plants. This is an expedient to massive improvement in production efficiency, since it diminishes the number of plants per phytochemical unit. Consequently, any other production costs (e.g. growing space, water, nutrient and transport) may be reduced markedly. Finally, 24 research articles published between 2013 and 2017 were reviewed for targeted use of LEDs in the specific, i.e. blue range (400-500 nm) of spectrum. The articles indicate that blue light is efficient in enhancing the accumulation of health beneficial phytochemicals in various species. The finding is important for global food production. © 2017 Society of Chemical Industry.

Eu(3+) co-doped ZnO/Zn2SiO4:Mn(2+) composites were synthesized via conventional solid state reaction route and were characterized by X-ray diffraction (XRD) scanning electron microscopy (SEM) and Fourier transform infra-red (FTIR) techniques. XRD studies reveal the presence of both ZnO and Zn2SiO4 phases. Photoluminescence properties of the samples were studied using 266 Nd-YAG laser excitations. Emission bands observed at ~400 nm are ascribed to ZnO phosphor. The green emission bands at 530 nm is associated with the presence of Mn(2+) ion, while orange (~583) and red (615 nm) bands are supposed to be due to the presence of Eu(3+) doped Zn2SiO4 phosphor. Energy transfer from power dependence of the sample for electric dipole transition (615 nm) was studied under 532 nm excitation by varying the power from 0.1 to 4.5 W. The estimated colour correlated temperature (CCT) values are found to be ~4875 and 4458 K under 266 nm and 532 nm laser (0.5 W) excitations. These values are close to those of tubular fluorescent or cool white/daylight compact fluorescent (CFL) (~5000 K) lamps. The present composite phosphor may have potential application in display devices.

Carbon and nitrogen (C-N) co-doped nano-CeO2 was synthesized by the solvothermal method using hexamethylenetetramine (HMT) as a precipitator at 140 degrees C for 24 h. We found that the degradation of acid orange 7 (AO7) was 94.4% and 98.8% with C-N co-doped nano-CeO2 upon irradiation with a 100-watt high-pressure mercury lamp (HML) and a 10-watt compact fluorescent lamp (CFL), respectively. By comparison, TiO2 degraded 68.4% and 43.0% of the AO7 irradiated by HML and CFL, respectively. We found that the degradation efficiencies of AO7 upon irradiation with the 10-watt CFL in the presence of the samples synthesized using different precipitators decreased as follows: CeO2(HMT>> CeO2-TiO2(HMT)>> TiO2(HMT)>>) CeO2(NaHCO3)>> CeO2(Na2CO3).

<AbstractText>Evaluating images of the lateral ligament of the ankle is not easy, and evaluation of the calcaneofibular ligament (<em>CFL</em>) in particular is difficult. We prospectively conducted morphological measurements of the <em>CFL</em> in different ankle positions and obtain basic data for use in functional assessment of the <em>CFL</em>, diagnosis of <em>CFL</em> injury, and determination of treatment effects.</AbstractText><AbstractText>The subjects were ten healthy volunteers (ten ankles) with a mean age of 27.8 years and no history of ankle disease. Imaging was done using a 3-T magnetic resonance imaging (MRI) machine and fast imaging employing steady-state acquisition cycled phases (FIESTA-C), a three-dimensional (3D) sequence, with the ankle in a neutral position, maximum dorsiflexion, and maximum plantar flexion. 3D images of the <em>CFL</em>, peroneal muscle tendons, fibula, and calcaneus were prepared at a workstation, and morphological measurements of the <em>CFL</em> were made.</AbstractText><AbstractText>In all positions, the <em>CFL</em> showed a gently curving course with the peroneal muscle tendons as a fulcrum. The tortuosity angle was significantly smaller in plantar flexion (30.0° ± 7.4°) than in the neutral position (41.7° ± 8.3°).</AbstractText><AbstractText>3D MRI sequences showed that, in all positions, the <em>CFL</em> curved due to the influence of the peroneal muscle tendons. With maximum plantar flexion, the <em>CFL</em> tortuosity angle was small, which was thought to have been due to the tension in the <em>CFL</em>.</AbstractText>

The pharmacokinetics of enrofloxacin (EFL) was investigated in turkeys (6 male and 6 female; 7-month-old at the start of the experiment), after intravenous and oral administration at a dose of 10 mg/kg body weight. The serum concentrations of EFL and its active metabolite ciprofloxacin (CFL) were determined by high-performance liquid chromatography. The serum concentrations vs time were analysed by a compartmental analysis. The mean values of EFL pharmacokinetic parameters showed differences only between values of V(d,ss) (3.46+/-0.19 for the females and 4.53+/-0.11 L/kg for the males, p>0.05). The metabolite CFL was eliminated more slowly than its parent compound. There were no statistically significant differences between the values of the CFL pharmacokinetic parameters calculated for both sexes, excluding the higher values (p>0.05) of C(max) in the females. The ratio AUC(CFL)/AUC(EFL)x100 was 4.4% in the male and 6.84% in the female birds. After oral administration of EFL the values of F(%) were 77.83 in the female and 79.61 in the male turkeys. Higher CFL serum concentrations were measured in females (p>0.05). The pharmacokinetics of enrofloxacin and its metabolite ciprofloxacin in turkeys can be characterized as similar to that in chickens and very similar between both sexes.

The influence from the manufacturing of compact fluorescent lamps (CFL) on mercury (Hg) speciation and distribution in river catchments nearby a typical CFL manufacturing area in China was investigated. Water, sediment, river snail (Procambarus clarkii), and macrophyte (Paspalum distichum L.) samples were collected. Total Hg (THg) and methylmercury (MeHg) concentrations in water ranged from 1.06 to 268 ng · L(-1) and N.D. -2.14 ng · L(-1), respectively. MeHg was significantly positively correlated with THg in water. THg and MeHg in sediment ranged from 15.0 to 2480 and 0.06 to 1.85 ng · g(-1), respectively. River snail samples exhibited high concentrations of THg (206-1437 ng · g(-1)) and MeHg (31.4-404 ng · g(-1)). THg and MeHg concentrations in root of P. distichum L. were significantly higher than those in shoot, indicating that THg and MeHg in the plant were mainly attributed to root assimilation. A very high bioaccumulation factor (20.9 ± 22.1) for MeHg in P. distichum L was noted, suggesting that P. distichum L. might have a potential role in phytoremediating MeHg contaminated soil due to its abnormal uptake capacity to MeHg.

Since 2007, a new disease of onion (Allium cepa) called yellow bud has been a problem in Georgia. Emerging leaves display intense chlorosis and older leaves exhibit extensive leaf blight. Yield reductions can be severe due to stand loss and reduced bulb size. Symptomatic plants are also more prone to freeze damage. The suspected causal agent is a slow-growing, white bacterium isolated onto nutrient agar (NA) by streak isolation. The bacterium grew more vigorously on NA supplemented with 0.5% yeast extract (NA+). Six strains of the bacterium all had gram-negative, rod-shaped cells and were strict aerobes. The strains produced levan, were negative for oxidase, potato rot, and arginine dihydrolase, and produced a hypersensitive reaction in tobacco. These are all characteristics of Pseudomonas group Ia as outlined by Lelliott et al. (2) and differ from characteristics of known Pseudomonas pathogens of onion such as P. aeruginosa, P. marginalis, and P. viridiflava that belong to groups Va, IVa, and II, respectively. The yellow bud bacterial strains were also nonfluorescent on King's medium B and were ice nucleation active. Universal primers PA16SF and PA16SR (ATCCTGGCTCAGATTGAACG and TTCCCCTACGGTTACCTTGTT) were used to amplify the 16S rRNA gene. The resulting consensus nucleotide sequence (GenBank Accession No. JF939841) of the six isolates matched those strains of P. syringae pv. atropurpurea, P. syringae pv. maculicola, P. syringae pv. porri, and P. amygdali (96 to 98% similarity). Primers 1 and 2 (GGCGCTCCCTCGCACTT and GGTATTGGCGGGGGTGC) were used to amplify the coronafacate ligase (cfl) gene. The resulting consensus nucleotide sequence for the six isolates (GenBank Accession No. JF939842) matched the cfl gene from P. syringae pv. tomato, P. syringae pv. morsprunorum, P. syrinage pv. aesculi, and P. syringae pv. glycinea (97 to 99% similarity). Representative strains had 0.95 to 0.99% similarity to P. syringae pv. coronafaciens using Biolog (Biolog, Hayward, CA), and 0.72 to 0.96% similarity to P. syringaepv. tomato using fatty acid analysis (MIDI Inc., Newark, DE). For each of eight representative yellow bud strains, 10 greenhouse-grown onion seedlings of cv. Pegasus were inoculated on one leaf. Bacteria grown on NA+ were suspended in sterile tap water and adjusted to ~1 × 10⁸ CFU/ml. With a hypodermic syringe and needle, 1.0 ml of inoculum was injected in to the hollow cavity of an emerging onion leaf. Chlorosis developed on inoculated leaves in 5 days and was identical to that observed with natural infections. All inoculated plants died within 14 days, confirming pathogenicity. Bacteria with characteristics described above were reisolated from symptomatic leaves. Ten control plants inoculated with sterile water remained asymptomatic. Based on the methods listed above, the yellow bud bacterium was identified as P. syringae, but pathovar designation or genomospecies (1) could not be determined because results varied among the different methods tested. The disease has been spreading throughout the Vidalia onion-growing region since it was first observed. There is significant potential for the disease to become more widespread since it also has been observed in direct-seeded, onion transplant beds. References: (1) J. P. Euzéby. List of Prokaryotic Names with Standing in Nomenclature-Genus Pseudomonas. Online publication. Retrieved from http://www.bacterio.cict.fr/p/pseudomonas.html , 2010. (2) R. A. Lelliott et al. J. Appl. Bact. 29:470, 1966.

Background: To examine critical interactions between juvenile idiopathic arthritis synovial fibroblasts (JFLS) and chondrocytes (Ch), and their role in bony overgrowth seen in patients with juvenile idiopathic arthritis (JIA).

Methods: Control (CFLS) and JFLS were cultured in synoviocyte media containing recombinant BMP4. Ch were cultured in either CFLS or JFLS conditioned-media without stimulation. Media supernatants were analyzed by ELISA. RNA from conditioned media experiment was analyzed by ClariomS microarray.

Results: As expected, genes expressed in untreated JFLS and CFLS cultured in synoviocyte media were similar to each other and this expression differed from untreated Ch cultured in chondrocyte media. JFLS favor BMP ligand gene expression while downregulating TGFβ receptors' expression. Noggin and chordin, antagonists with high affinity for BMP4, are JFLS- but not Ch-preferred regulators of BMP signaling. Compared to Ch, JFLS overexpress collagen X (COLX), a marker of chondrocyte hypertrophy. Exogenous BMP4 causes JFLS to significantly decrease expression of noggin and collagen II (COL2), a marker of chondrocyte proliferation, and causes overexpression of COLX and alkaline-phosphatase (ALP). Chondrocytes cultured in JFLS-conditioned media (Ch-JFLS) express BMP genes and favor chordin protein expression over other antagonists. Ch-JFLS have significantly increased expression of COL2 and significantly decreased expression of COLX.

Conclusions: These data suggest JFLS, in the presence of BMP4, undergo hypertrophy and that JFLS-conditioned media influence chondrocytes to become highly proliferative. To the authors' knowledge, no prior study has shown that JFLS and chondrocytes play a direct role in the bony overgrowth in joints of patients with JIA and that BMPs or regulation of these growth factors influence the interaction between two prominent synovial cell types.

Keywords: BMP antagonists; BMP4; Chondrocyte; Endochondral bone; Fibroblast; Hypertrophy; Juvenile idiopathic arthritis; Proliferation; Synoviocyte; TGFβ.

Drugs used to treat pain are associated with adverse effects, increasing the search for new drugs as an alternative treatment for pain. Therefore, we evaluated the antinociceptive behavior and possible neuromodulation mechanisms of triterpene 3β, 6β, 16β-trihydroxylup-20(29)-ene (CLF-1) isolated from Combretum leprosum leaves in zebrafish. Zebrafish (n = 6/group) were pretreated with CLF-1 (0.1 or 0.3 or 1.0 mg/mL; i.p.) and underwent nociception behavior tests. The antinociceptive effect of CFL-1 was tested for modulation by opioid (naloxone), nitrergic (L-NAME), nitric oxide and guanylate cyclase synthesis inhibitor (methylene blue), NMDA (Ketamine), TRPV1 (ruthenium red), TRPA1 (camphor), or ASIC (amiloride) antagonists. The corneal antinociceptive effect of CFL-1 was tested for modulation by TRPV1 (capsazepine). The effect of CFL-1 on zebrafish locomotor behavior was evaluated with the open field test. The acute toxicity study was conducted. CLF-1 reduced nociceptive behavior and corneal in zebrafish without mortalities and without altering the animals' locomotion. Thus, CFL-1 presenting pharmacological potential for the treatment of acute pain and corneal pain, and this effect is modulated by the opioids, nitrergic system, NMDA receptors and TRP and ASIC channels.

Keywords: Combretum leprosum; Triterpene; Zebrafish.

In this study, we demonstrate a method for controlling breast cancer cells adhesion on polyelectrolyte multilayer (PEM) films without the aid of adhesive proteins/ligands to study the role of tumor and stromal cell interaction on cancer biology. Numerous studies have explored engineering coculture of tumor and stromal cells predominantly using transwell coculture of stromal cells cultured onto coverslips that were subsequently added to tumor cell cultures. However, these systems imposed an artificial boundary that precluded cell-cell interactions. To our knowledge, this is the first demonstration of patterned coculture of tumor cells and stromal cells that captures the temporal changes in the miRNA signature as the breast tumor develops through various stages. In our study we used synthetic polymers, namely poly(diallyldimethylammonium chloride) (PDAC) and sulfonated poly(styrene) (SPS), as the polycation and polyanion, respectively, to build PEMs. Breast cancer cells attached and spread preferentially on SPS surfaces while stromal cells attached to both SPS and PDAC surfaces. SPS patterns were formed on PEM surfaces, by either capillary force lithography (CFL) of SPS onto PDAC surfaces or vice versa, to obtain patterns of breast cancer cells and patterned cocultures of breast cancer and stromal cells. In this study, we utilized cancer cells derived from two different tumor stages and two different stromal cells to effectively model a heterogeneous tumor microenvironment and emulate various tumor stages. The coculture model mimics the proliferative index (Ki67 expression) and tumor aggressiveness (HER-2 expression) akin to those observed in clinical tumor samples. We also demonstrated that our patterned coculture model captures the temporal changes in the miRNA-21 and miRNA-34 signature as the breast tumor develops through various stages. The engineered coculture platform lays groundwork toward precision medicine wherein patient-derived tumor cells can be incorporated within our in vitro models to identify potential pathways and drug treatment regimens for individual patients.

Surface patterning is an attractive approach to modify the surface of biomaterials for modulating cell activities and enhancing the performance of medical implants without involving typical chemical changes to the implants such as adding growth factors, antibiotics, and drugs. In this study, nano-to-micron patterns were engineered on thermoplastic and thermoset polymer coatings on bioresorbable magnesium (Mg) substrates to control the cellular responses and material degradation for vascular applications. Capillary force lithography (CFL) was modified and integrated with spray coating to fabricate well-aligned nano-to-micron patterns on the thermoplastic poly(lactic-co-glycolic acid) (PLGA) and thermoset poly(glycerol sebacate) (PGS) coatings on Mg substrates. Specifically, a new process of molding-curing CFL was revised from the conventional CFL to successfully create nano-to-submicron patterns on thermoset PGS for the first time. The nano-to-micron-patterned polymer coatings of PLGA and PGS on Mg were carefully characterized, and their effects on cell adhesion and morphology were investigated through direct culture with human umbilical vein endothelial cells (HUVECs) in vitro. The results showed that the 3000 nm parallel grooves could effectively elongate the HUVECs, while the 740 nm parallel grooves tended to reduce the spreading of HUVECs. The PLGA coatings reduced the degradation of Mg substrates more than that of the PGS coatings in the direct culture with HUVECs in vitro. CFL-based methods coupled with spray coating should be further studied as a nonchemical approach for creating nano-to-micron-patterned polymer coatings on Mg-based substrates of various sizes and shapes, which may present a new direction for improving the performance of Mg-based bioresorbable vascular devices toward potential clinical translation.

Keywords: capillary force lithography (CFL); in vitro direct culture method; nano-to-micron surface patterning; thermoplastic and thermoset polymer coatings on bioresorbable magnesium (Mg); vascular devices such as stents and grafts.

Purpose: The purpose of the present anatomical study was to define the exact morphology of the posterior fibulotalocalcaneal ligament complex (PFTCLC), both for a better orientation and understanding of the anatomy, especially during hindfoot endoscopy.

Methods: Twenty-three fresh frozen specimens were dissected in order to clarify the morphology of the PFTCLC.

Results: In all specimens, the ligament originated from the posteromedial border of the lateral malleolus between the posterior tibiofibular ligament (superior border) and the calcaneofibular ligament (CFL), (inferior border). This origin functions as the floor for the peroneal tendon sheath. The origin of the PFTCLC can be subdivided into two parts, a superior and inferior part. The superior part forms an aponeurosis with the superior peroneal retinaculum and the lateral septum of the Achilles tendon. From this structure, two independent laminae can be identified. The inferior part of the origin has no role in the aponeurosis and ligamentous fibres run obliquely to insert in the lateral surface of the calcaneus, in the same orientation as the CFL, but slightly more posterior, which was a consistent finding in all examined specimens. The PFTCLC is maximally tensed with ankle dorsiflexion and is located within the fascia of the deep posterior compartment of the leg.

Conclusions: The PFTCLC is part of the normal anatomy of the hindfoot and therefore should be routinely recognized and partly released to achieve access to the posterior ankle anatomical pathology, relevant for hindfoot endoscopy. The origin of the ligament complex forms the floor for the peroneal tendon sheath. The superior part of the origin plays a role in the formation of an aponeurosis with the superior peroneal retinaculum and the lateral septum of the Achilles tendon.

Keywords: Ankle anatomy; Hindfoot endoscopy; Posterior fibulotalocalcaneal ligament; Rouvière and canela ligament; Superior peroneal retinaculum.

The present work focuses on the in-silico investigation of the steady-state blood flow in straight microtubes, incorporating advanced constitutive modeling for human blood and blood plasma. The blood constitutive model accounts for the interplay between thixotropy and elasto-visco-plasticity via a scalar variable that describes the level of the local blood structure at any instance. The constitutive model is enhanced by the non-Newtonian modeling of the plasma phase, which features bulk viscoelasticity. Incorporating microcirculation phenomena such as the cell-free layer (CFL) formation or the Fåhraeus and the Fåhraeus-Lindqvist effects is an indispensable part of the blood flow investigation. The coupling between them and the momentum balance is achieved through correlations based on experimental observations. Notably, we propose a new simplified form for the dependence of the apparent viscosity on the hematocrit that predicts the CFL thickness correctly. Our investigation focuses on the impact of the microtube diameter and the pressure-gradient on velocity profiles, normal and shear viscoelastic stresses, and thixotropic properties. We demonstrate the microstructural configuration of blood in steady-state conditions, revealing that blood is highly aggregated in narrow tubes, promoting a flat velocity profile. Additionally, the proper accounting of the CFL thickness shows that for narrow microtubes, the reduction of discharged hematocrit is significant, which in some cases is up to 70%. At high pressure-gradients, the plasmatic proteins in both regions are extended in the flow direction, developing large axial normal stresses, which are more significant in the core region. We also provide normal stress predictions at both the blood/plasma interface (INS) and the tube wall (WNS), which are difficult to measure experimentally. Both decrease with the tube radius; however, they exhibit significant differences in magnitude and type of variation. INS varies linearly from 4.5 to 2 Pa, while WNS exhibits an exponential decrease taking values from 50 mPa to zero.

Keywords: CFL; aggregation; amp; blood flow; blood thixotropy; blood viscoelasticity; fåhraeus effect; hemodynamics; interfacial shear & microtubes; normal stresses; personalized hemorheology; plasma viscoelasticity; relaxation time; rouleaux; wall shear &.

OBJECTIVE

Distinction between primary cutaneous follicular lymphoma (PCFL) and primary cutaneous marginal zone lymphoma (PCMZL) is challenging, as clear-cut immunophenotypical and cytogenetic criteria to segregate both entities are lacking.

RESULTS

To characterize PCFL and PCMZL more clearly and to define criteria helpful for the differential diagnosis, we compared expression of immunohistochemical markers [LIM-only transcription factor 2 (LMO2), human germinal centre-associated lymphoma (HGAL), stathmin 1 (STMN1), activation-induced cytidine deaminase (AID), myeloid cell nuclear differentiation antigen (MNDA)] and the presence of cytogenetic abnormalities described previously in nodal follicular lymphoma [B cell lymphoma 2 (BCL2) and BCL6 breaks, 1p36 chromosomal region deletion (del 1p36)] in a series of 48 cutaneous follicular and marginal zone lymphomas [cutaneous follicular lymphoma (CFL) and cutaneous marginal zone lymphoma (CMZL)]. Immunostaining for STMN1, LMO2, HGAL and AID allowed the distinction between CFL and CMZL, and STMN1 was the most sensitive marker (100% CFL, 0% CMZL). LMO2, HGAL and AID were positive in 93.2%, 82.1% and 86.2% CFL (all CMZL-negative). MNDA was expressed in both entities without significant difference (10.3% CFL, 30.8% CMZL, P = 0.18). BCL2, BCL6 breaks and the del 1p36 were present in 16.7%, 10.7% and 18.5% CFL and no CMZL. Finally, three and 29 CFL were reclassified as secondary cutaneous follicular lymphomas (SCFL) and PCFL without significant differences concerning phenotypical and cytogenetic features. BCL2, BCL6 breaks and the del 1p36 were present in 11.1%, 8% and 16.7% PCFL and did not impact the prognosis.

CONCLUSIONS

LMO2, HGAL, STMN1 and AID, but not MNDA, are discriminant for the recognition between CFL and CMZL. BCL2, BCL6 rearrangements and the del 1p36 have a role in the pathogenesis of PCFL, the latest being the most common alteration.

BACKGROUND

The traditional method of assessing minimal phototoxic dose (MPD) prior to photochemotherapy with psoralen-ultraviolet A (PUVA) is inconvenient and cannot directly determine PUVA start doses. A handheld minimal erythema dose UVB tester can be modified by fitting a TL-10 UVA compact fluorescence lamp (CFL).

OBJECTIVE

To determine whether MPD testing is possible with a CFL and to calculate a fixed factor to convert observed MPD to PUVA-equivalent MPD.

METHODS

Patients had two sets of MPD tests performed on symmetrical, contralateral sites on the lower back. MPD test results from a panel of PUVA lamps were compared with MPD from the modified handheld tester. Additionally, a questionnaire survey was completed by 43 U.K. phototherapy units to assess routine practice concerning MPD testing prior to PUVA therapy.

RESULTS

Thirty-seven patients with psoriasis were recruited. Boston phototypes in the 31 with conclusive MPD reactions were: I, four; II, 11; III, 12; and IV, four. The handheld MPD results were linearly related to the PUVA panel MPD results as follows: PUVA MPD = 0·48 × handheld MPD + 0·17 J cm(-2). The measured PUVA MPD was 0·48 of the handheld MPD, not 0·15 as predicted by the published PUVA action spectrum.

CONCLUSIONS

The modified MPD tester is a convenient and safe method for PUVA MPD testing, overcoming many problems of the 'traditional method'. The difference between the PUVA and TL-10 lamps was lower than predicted from published studies. This suggests that formal re-evaluation of the erythema action spectrum for PUVA is now needed.