An increase in the activity of mitogen-activated protein kinase (MAPK) has been correlated with the progression of prostate cancer to advanced disease in humans. The serine/threonine protein kinase p90-kDa ribosomal S6 kinase (RSK) is an important downstream effector of MAPK but its role in prostate cancer has not previously been examined. Increasing RSK isoform 2 (RSK2) levels in the human prostate cancer line, LNCaP, enhanced prostate-specific antigen (PSA) expression, an important diagnostic marker for prostate cancer, whereas inhibiting RSK activity using a RSK-specific inhibitor, 3Ac-SL0101, decreased PSA expression. The RSK2 regulation of PSA expression occurred via a mechanism involving both RSK2 kinase activity and its ability to associate with the coactivator, p300. RNA interference of the androgen receptor (AR) showed that the AR was important in the RSK2-mediated increase in PSA expression. RSK levels are higher in approximately 50% of human prostate cancers compared with normal prostate tissue, which suggests that increased RSK levels may participate in the rise in PSA expression that occurs in prostate cancer. Furthermore, 3Ac-SL0101 inhibited proliferation of the LNCaP line and the androgen-independent human prostate cancer line, PC-3. These results suggest that proliferation of some prostate cancer cells is dependent on RSK activity and support the hypothesis that RSK may be an important chemotherapeutic target for prostate cancer.

The androgen receptor (AR) signaling pathway is involved in the emergence of castration-resistant prostate cancer (CRPC). Here, we identified several androgen-regulated microRNAs (miRNAs) that may contribute to the development of CRPC. Seven miRNAs, miR-21, miR-32, miR-99a, miR-99b, miR-148a, miR-221 and miR-590-5p, were found to be differentially expressed in CRPC compared with benign prostate hyperplasia (BPH) according to microarray analyses. Significant growth advantage for LNCaP cells transfected with pre-miR-32 and pre-miR-148a was found. miR-32 was demonstrated to reduce apoptosis, whereas miR-148a enhanced proliferation. Androgen regulation of miR-32 and miR-148a was confirmed by androgen stimulation of the LNCaP cells followed by expression analyses. The AR-binding sites in proximity of these miRNAs were demonstrated with chromatin immunoprecipitation (ChIP). To identify target genes for the miRNAs, mRNA microarray analyses were performed with LNCaP cells transfected with pre-miR-32 and pre-miR-148a. Expression of BTG2 and PIK3IP1 was reduced in the cells transfected with pre-miR-32 and pre-miR-148a, respectively. Also, the protein expression was reduced according to western blot analysis. BTG2 and PIK3IP1 were confirmed to be targets by 3'UTR-luciferase assays. Finally, immunostainings showed a statistically significant (P<0.0001) reduction of BTG2 protein in CRPCs compared with untreated prostate cancer (PC). The lack of BTG2 staining was also associated (P<0.01) with a short progression-free time in patients who underwent prostatectomy. In conclusion, androgen-regulated miR-32 is overexpressed in CRPC, leading to reduced expression of BTG2. Thus, miR-32 is a potential marker for aggressive disease and is a putative drug target in PC.

Bronchodilators are central in the treatment of of airways disorders. They are the mainstay of the current management of chronic obstructive pulmonary disease (COPD) and are critical in the symptomatic management of asthma, although controversies around the use of these drugs remain. Bronchodilators work through their direct relaxation effect on airway smooth muscle cells. at present, three major classes of bronchodilators, β(2)-adrenoceptor (AR) agonists, muscarinic receptor antagonists, and xanthines are available and can be used individually or in combination. The use of the inhaled route is currently preferred to minimize systemic effects. Fast- and short-acting agents are best used for rescue of symptoms, whereas long-acting agents are best used for maintenance therapy. It has proven difficult to discover novel classes of bronchodilator drugs, although potential new targets are emerging. Consequently, the logical approach has been to improve the existing bronchodilators, although several novel broncholytic classes are under development. An important step in simplifying asthma and COPD management and improving adherence with prescribed therapy is to reduce the dose frequency to the minimum necessary to maintain disease control. Therefore, the incorporation of once-daily dose administration is an important strategy to improve adherence. Several once-daily β(2)-AR agonists or ultra-long-acting β(2)-AR-agonists (LABAs), such as indacaterol, olodaterol, and vilanterol, are already in the market or under development for the treatment of COPD and asthma, but current recommendations suggest the use of LABAs only in combination with an inhaled corticosteroid. In addition, some new potentially long-acting antimuscarinic agents, such as glycopyrronium bromide (NVA-237), aclidinium bromide, and umeclidinium bromide (GSK573719), are under development, as well as combinations of several classes of long-acting bronchodilator drugs, in an attempt to simplify treatment regimens as much as possible. This review will describe the pharmacology and therapeutics of old, new, and emerging classes of bronchodilator.

Exposure of beta-adrenergic receptors (beta ARs) to agonists causes rapid desensitization of the receptor-stimulated adenylyl cyclase response. Three main mechanisms have been implicated in this process: phosphorylation of the receptors by the cAMP-dependent protein kinase (PKA), phosphorylation by the specific agonist-dependent beta AR kinase, and sequestration of the receptors away from the cell surface. By applying inhibitors of these processes to digitonin-permeabilized A431 cells we investigated their contributions to beta AR desensitization. Each process could be selectively inhibited: PKA-dependent phosphorylation by an inhibitor peptide (amino acids 1-24 of the heat-stable inhibitor of PKA (PKI], beta AR kinase-dependent phosphorylation by heparin, and sequestration by concanavalin A. In permeabilized cells, heparin plus PKI completely blocked agonist-induced phosphorylation of the beta ARs. Desensitization was assessed by quantitating the signal transduction efficacy of the system. At high agonist concentrations (approximately 1 microM) up to 70% desensitization occurred. Complete blockade of this desensitization required the concurrent inhibition of all three pathways. When individual pathways were blocked it could be demonstrated that either the PKA or beta AR kinase mechanisms alone resulted in 40-50% desensitization whereas sequestration alone caused 20-30% desensitization. At low agonist concentrations (approximately 10 nM), the PKA pathway was selectively activated. These data indicate that while desensitization mediated via the three different mechanisms can occur independently, the quantitative contributions are not additive. Such findings suggest distinct but overlapping physiological roles for each mechanism in controlling receptor function.

BACKGROUND

Concerns have been raised about the biological and toxicologic effects of the antimicrobials triclocarban (TCC) and triclosan (TCS) in personal care products. Few studies have evaluated their biological activities in mammalian cells to assess their potential for adverse effects.

OBJECTIVE

In this study, we assessed the activity of TCC, its analogs, and TCS in in vitro nuclear-receptor-responsive and calcium signaling bioassays.

METHODS

We determined the biological activities of the compounds in in vitro, cell-based, and nuclear-receptor-responsive bioassays for receptors for aryl hydrocarbon (AhR), estrogen (ER), androgen (AR), and ryanodine (RyR1).

RESULTS

Some carbanilide compounds, including TCC (1-10 muM), enhanced estradiol (E(2))-dependent or testosterone-dependent activation of ER- and AR-responsive gene expression up to 2.5-fold but exhibited little or no agonistic activity alone. Some carbanilides and TCS exhibited weak agonistic and/or antagonistic activity in the AhR-responsive bioassay. TCS exhibited antagonistic activity in both ER- and AR-responsive bioassays. TCS (0.1-10 muM) significantly enhanced the binding of [(3)H]ryanodine to RyR1 and caused elevation of resting cytosolic [Ca(2+)] in primary skeletal myotubes, but carbanilides had no effect.

CONCLUSIONS

Carbanilides, including TCC, enhanced hormone-dependent induction of ER- and AR-dependent gene expression but had little agonist activity, suggesting a new mechanism of action of endocrine-disrupting compounds. TCS, structurally similar to noncoplanar ortho-substituted poly-chlorinated biphenyls, exhibited weak AhR activity but interacted with RyR1 and stimulated Ca(2+) mobilization. These observations have potential implications for human and animal health. Further investigations are needed into the biological and toxicologic effects of TCC, its analogs, and TCS.

OBJECTIVE

Androgen effects on hepatocellular carcinoma (HCC) remain controversial and androgen ablation therapy to treat HCC also leads to inconsistent results. Here we examine androgen receptor (AR) roles in hepatocarcinogenesis using mice lacking AR in hepatocytes.

METHODS

By using the Cre-Lox conditional knockout mice model injected with carcinogen, we examined the AR roles in hepatocarcinogenesis. We also tested the possible roles of AR in cellular oxidative stress and DNA damage sensing/repairing systems. By using AR degrading compound, ASC-J9, or AR-small interference RNA, we also examined the therapeutic potentials of targeting AR in HCC.

RESULTS

We found AR expression was increased in human HCC compared with normal livers. We also found mice lacking hepatic AR developed later and less HCC than their wild-type littermates with comparable serum testosterone in both male and female mice. Addition of functional AR in human HCC cells also resulted in the promotion of cell growth in the absence or presence of 5alpha-dihydrotestosterone. Mechanistic dissection suggests that AR may promote hepatocarcinogenesis via increased cellular oxidative stress and DNA damage, as well as suppression of p53-mediated DNA damage sensing/repairing system and cell apoptosis. Targeting AR directly via either AR-small interference RNA or ASC-J9 resulted in suppression of HCC in both ex vivo cell lines and in vivo mice models.

CONCLUSIONS

Our data point to AR, but not androgens, as a potential new and better therapeutic target for the battle of HCC.

Androgen receptor (AR) is essential for the growth and progression of prostate cancer in both hormone-sensitive and hormone-refractory disease. A DNA-binding polyamide that targets the consensus androgen response element binds the prostate-specific antigen (PSA) promoter androgen response element, inhibits androgen-induced expression of PSA and several other AR-regulated genes in cultured prostate cancer cells, and reduces AR occupancy at the PSA promoter and enhancer. Down-regulation of PSA by this polyamide was comparable to that produced by the synthetic antiandrogen bicalutamide (Casodex) at the same concentration. Genome-wide expression analysis reveals that a similar number of transcripts are affected by treatment with the polyamide and with bicalutamide. Direct inhibition of the AR-DNA interface by sequence-specific DNA binding small molecules could offer an alternative approach to antagonizing AR activity.

Despite increasing pharmaceutical importance, fluorinated aromatic organic molecules remain difficult to synthesize. Present methods require either harsh reaction conditions or highly specialized reagents, making the preparation of complex fluoroarenes challenging. Thus, the development of general methods for their preparation that overcome the limitations of those techniques currently in use is of great interest. We have prepared [LPd(II)Ar(F)] complexes, where L is a biaryl monophosphine ligand and Ar is an aryl group, and identified conditions under which reductive elimination occurs to form an Ar-F bond. On the basis of these results, we have developed a catalytic process that converts aryl bromides and aryl triflates into the corresponding fluorinated arenes by using simple fluoride salts. We expect this method to allow the introduction of fluorine atoms into advanced, highly functionalized intermediates.

Androgen receptors (ARs) are phosphorylated at multiple sites in response to ligand binding, but the kinases mediating AR phosphorylation and the importance of these kinases in AR function have not been established. Here we show that cyclin-dependent kinase 1 (Cdk1) mediates AR phosphorylation at Ser-81 and increases AR protein expression, and that Cdk1 inhibitors decrease AR Ser-81 phosphorylation, protein expression, and transcriptional activity in prostate cancer (PCa) cells. The decline in AR protein expression mediated by the Cdk inhibitor roscovitine was prevented by proteosome inhibitors, indicating that Cdk1 stabilizes AR protein, although roscovitine also decreased AR message levels. Analysis of an S81A AR mutant demonstrated that this site is not required for transcriptional activity or Cdk1-mediated AR stabilization in transfected cells. The AR is active and seems to be stabilized by low levels of androgen in "androgen-independent" PCas that relapse subsequent to androgen-deprivation therapy. Significantly, the expression of cyclin B and Cdk1 was increased in these tumors, and treatment with roscovitine abrogated responses to low levels of androgen in the androgen-independent C4-2 PCa cell line. Taken together, these findings identify Cdk1 as a Ser-81 kinase and indicate that Cdk1 stabilizes AR protein by phosphorylation at a site(s) distinct from Ser-81. Moreover, these results indicate that increased Cdk1 activity is a mechanism for increasing AR expression and stability in response to low androgen levels in androgen-independent PCas, and that Cdk1 antagonists may enhance responses to androgen-deprivation therapy.

Antibiotic use is known to promote the development of antibiotic resistance, but substantial controversy exists about the impact of agricultural antibiotic use (AAU) on the subsequent emergence of antibiotic-resistant bacteria among humans. AAU for animal growth promotion or for treatment or control of animal diseases generates reservoirs of antibiotic-resistant (AR) bacteria that contaminate animal food products. Mathematical models are an important tool for understanding the potential medical consequences of this increased exposure. We have developed a mathematical model to evaluate factors affecting the prevalence of human commensal AR bacteria that cause opportunistic infections (e.g., enterococci). Our analysis suggests that AAU hastens the appearance of AR bacteria in humans. Our model indicates that the greatest impact occurs very early in the emergence of resistance, when AR bacteria are rare, possibly below the detection limits of current surveillance methods.

Prostate cancers (PCa) that relapse after androgen deprivation therapy invariably express high levels of androgen receptor (AR) and AR-regulated genes. Most do not respond to secondary hormonal therapies, including AR antagonists, and the mechanisms of AR activation in these clinically androgen-independent tumors are unclear. Bicalutamide, the most widely used AR antagonist, is a competitive antagonist shown previously to stabilize AR association with cytosolic heat shock protein complexes. This study found nuclear AR expression in bicalutamide-treated androgen-independent PCa and found that bicalutamide could stimulate AR nuclear translocation. Moreover, specific DNA binding by the bicalutamide-liganded AR was demonstrated in vivo using a VP16-AR fusion protein and was confirmed by chromatin immunoprecipitation showing binding to the prostate-specific antigen enhancer in LNCaP PCa cells. Nonetheless, bicalutamide could not stimulate interactions between the AR N and C termini or recruitment of steroid receptor coactivator proteins (SRC-1 or -2), although SRC transfection augmented AR activity in the presence of dihydrotestosterone and inhibitory concentrations of bicalutamide. These results demonstrate that bicalutamide stimulates the assembly of a transcriptionally inactive AR on DNA and support altered coactivator (or corepressor) expression as a mechanism of bicalutamide-resistant androgen-independent PCa.

Despite advances in prostate cancer diagnosis and management, morbidity from prostate cancer remains high. Approximately 20% of men present with advanced or metastatic disease, while 29,000 men continue to die of prostate cancer each year. Androgen deprivation therapy (ADT) has been the standard of care for initial management of advanced or metastatic prostate cancer since Huggins and Hodges first introduced the concept of androgen-dependence in 1972, but progression to castration-resistant prostate cancer (CRPC) occurs within 2-3 years of initiation of ADT. CRPC, previously defined as hormone-refractory prostate cancer, is now understood to still be androgen dependent. Multiple mechanisms of resistance help contribute to the progression to castration resistant disease, and the androgen receptor (AR) remains an important driver in this progression. These mechanisms include AR amplification and hypersensitivity, AR mutations leading to promiscuity, mutations in coactivators/corepressors, androgen-independent AR activation, and intratumoral and alternative androgen production. More recently, identification of AR variants (ARVs) has been established as another mechanism of progression to CRPC. Docetaxel chemotherapy has historically been the first-line treatment for CRPC, but in recent years, newer agents have been introduced that target some of these mechanisms of resistance, thereby providing additional survival benefit. These include AR signaling inhibitors such as enzalutamide (Xtandi, ENZA, MDV-3100) and CYP17A1 inhibitors such as abiraterone acetate (Zytiga). Ultimately, these agents will also fail to suppress CRPC. While some of the mechanisms by which these agents fail are unique, many share similarities to the mechanisms contributing to CRPC progression. Understanding these mechanisms of resistance to ADT and currently approved CRPC treatments will help guide future research into targeted therapies.

The forkhead protein FoxA1 has functions other than a pioneer factor, in that its depletion brings about a significant redistribution in the androgen receptor (AR) and glucocorticoid receptor (GR) cistromes. In this study, we found a novel function for FoxA1 in defining the cell-type specificity of AR- and GR-binding events in a distinct fashion, namely, for AR in LNCaP-1F5 cells and for GR in VCaP cells. We also found different, cell-type and receptor-specific compilations of cis-elements enriched adjacent to the AR- and GR-binding sites. The AR pathway is central in prostate cancer biology, but the role of GR is poorly known. We find that AR and GR cistromes and transcription programs exhibit significant overlap, and GR regulates a large number of genes considered to be AR pathway-specific. This raises questions about the role of GR in maintaining the AR pathway under androgen-deprived conditions in castration-resistant prostate cancer patients. However, in the presence of androgen, ligand-occupied GR acts as a partial antiandrogen and attenuates the AR-dependent transcription program. .

The fission yeast, Schizosaccharomyces pombe, has been used extensively for genetic studies but until now it has not been utilized as a host organism for DNA cloning. Here we describe a method for high-frequency transformation fo a leu 1(-) strain of this yeast with hybrid plasmids containing the Saccharomyces cerevisiae LEu 2(+) gene, a bacterial plasmid and either the S. cerevisiae 2 μm plasmid or autonomously replicating sequences (ars)(1) derived from S. pombe DNA. Some of the plasmids contain unique restriction sites which make them suitable for the isolation of S. pombe genes, and they can also be used for the exchange of DNA between S. pombe and S. cerevisiae.

The current version of the androgen receptor (AR) gene mutations database is described. The total number of reported mutations has risen from 374 to 605, and the number of AR-interacting proteins described has increased from 23 to 70, both over the past 3 years. A 3D model of the AR ligand-binding domain (AR LBD) has been added to give a better understanding of gene structure-function relationships. In addition, silent mutations have now been reported in both androgen insensitivity syndrome (AIS) and prostate cancer (CaP) cases. The database also now incorporates information on the exon 1 CAG repeat expansion disease, spinobulbar muscular atrophy (SBMA), as well as CAG repeat length variations associated with risk for female breast, uterine endometrial, colorectal, and prostate cancer, as well as for male infertility. The possible implications of somatic mutations, as opposed to germline mutations, in the development of future locus-specific mutation databases (LSDBs) is discussed. The database is available on the Internet (http://www.mcgill.ca/androgendb/).

Androgen receptor (AR) is known to be overexpressed in castration-resistant prostate cancer. To interrogate the functional significance of the AR level, we established two LNCaP cell sublines expressing in a stable fashion two to four times (LNCaP-ARmo) and four to six times (LNCaP-ARhi) higher level of AR than the parental cell line expressing the empty vector (LNCaP-pcDNA3.1). LNCaP-ARhi cell line grew faster than the control line in low concentrations, especially in 1 nmol/L 5alpha-dihydrotestosterone (DHT). Microarray-based transcript profiling and subsequent unsupervised hierarchical clustering showed that LNCaP-ARhi cells clustered together with VCaP cells, containing endogenous AR gene amplification and overexpression, indicating the central role of AR in the overall regulation of gene expression in prostate cancer cells. Two hundred forty genes showed >2-fold changes on DHT treatment in LNCaP-ARhi at 4 h time point, whereas only 164 and 52 showed changes in LNCaP-ARmo and LNCaP-pcDNA3.1, respectively. Many androgen-regulated genes were upregulated in LNCaP-ARhi at 10-fold lower concentration of DHT than in control cells. DHT (1 nmol/L) increased expression of several cell cycle-associated genes in LNCaP-ARhi cells. ChIP-on-chip assay revealed the presence of chromatin binding sites for AR within +/-200 kb of most of these genes. The growth of LNCaP-ARhi cells was also highly sensitive to cyclin-dependent kinase inhibitor, roscovitine, at 1nmol/L DHT. In conclusion, our results show that overexpression of AR sensitizes castration-resistant prostate cancer cells to the low levels of androgens. The activity of AR signaling pathway is regulated by the levels of both ligand and the receptor.

Some forms of G protein-coupled receptor signaling, such as activation of mitogen-activated protein kinase cascade as well as resensitization of receptors after hormone-induced desensitization, require receptor internalization via dynamin-dependent clathrin-coated pit mechanisms. Here we demonstrate that activation of beta2-adrenergic receptors (beta2-ARs) leads to c-Src-mediated tyrosine phosphorylation of dynamin, which is required for receptor internalization. Two tyrosine residues, Tyr231 and Tyr597, are identified as the major phosphorylation sites. Mutation of these residues to phenylalanine dramatically decreases the c-Src-mediated phosphorylation of dynamin following beta2-AR stimulation. Moreover, expression of Y231F/Y597F dynamin inhibits beta2-AR internalization and the isoproterenol-stimulated mitogen-activated protein kinase activation. Thus, agonist-induced, c-Src-mediated tyrosine phosphorylation of dynamin is essential for its function in clathrin mediated G protein-coupled receptor endocytosis.

Spinal and bulbar muscular atrophy (SBMA) is one of a growing number of neurodegenerative diseases caused by a polyglutamine-encoding CAG trinucleotide repeat expansion, and is caused by an expansion within exon 1 of the androgen receptor (AR) gene. The family of polyglutamine diseases is characterized by the presence of ubiquitinated, intranuclear inclusions associated with molecular chaperones and 26S proteasome components, although the role of these inclusions in the pathogenesis of polyglutamine diseases remains unclear. The over-expression of molecular chaperones of the Hsp70 and Hsp40 families has been shown to modulate inclusion frequency and cellular toxicity. We developed a cell culture system which enables the quantitative analysis of the effects of molecular chaperones on the biochemical properties of an expanded repeat AR. Using this approach, we demonstrate that Hsp70 and its co-chaperone Hsp40 not only increase expanded repeat AR solubility, but function to enhance the degradation of expanded repeat AR through the proteasome. Furthermore, our studies indicate that these molecular chaperones significantly decrease the half-life of an expanded repeat AR. Molecular chaperone enhancement of protein degradation points to the modulation of molecular chaperones as a potential therapeutic target for polyglutamine diseases.

We show that theoretical microscopic titration curves (THEMATICS) can be used to identify active-site residues in proteins of known structure. Results are featured for three enzymes: triosephosphate isomerase (TIM), aldose reductase (AR), and phosphomannose isomerase (PMI). We note that TIM and AR have similar structures but catalyze different kinds of reactions, whereas TIM and PMI have different structures but catalyze similar reactions. Analysis of the theoretical microscopic titration curves for all of the ionizable residues of these proteins shows that a small fraction (3-7%) of the curves possess a flat region where the residue is partially protonated over a wide pH range. The preponderance of residues with such perturbed curves occur in the active site. Additional results are given in summary form to show the success of the method for proteins with a variety of different chemistries and structures.

The depth of seed dormancy can be influenced by a number of different environmental signals, but whether a common mechanism underlies this apparently similar response has yet to be investigated. Full-genome microarrays were used for a global transcript analysis of Arabidopsis thaliana Cape Verde Island accession seeds exposed to dry after-ripening (AR), or low temperature, nitrate and light when imbibed. Germination studies showed that the sensitivity of imbibed seeds to low temperature, nitrate and light was dependent upon the length of time spent AR following harvest. Seeds had an absolute requirement for light to complete dormancy release in all conditions, but this effect required an exposure to a prior dormancy relieving environment. Principal component analyses of the expression patterns observed grouped physiological states in a way that related to the depth of seed dormancy, rather than the type of environmental exposure. Furthermore, opposite changes in transcript abundance of genes in sets associated with dormancy, or dormancy relief through AR, were also related to the depth of dormancy and common to different environments. Besides these common quantitative changes, environment-specific gene expression patterns during dormancy relief are also described. For example, higher transcript abundance for genes linked to the process of nitrate accumulation, and nitrate reduction was associated with dormancy relief. The quantity of GA3ox1 transcripts increased during dormancy relief in all conditions, in particular when dormancy relief was completed by exposure to light. This contrasts with transcripts linked to abscisic acid (ABA) synthesis, which declined. The results are consistent with a role for the ABA/gibberellic acid balance in integrating dormancy-relieving environmental signals.

Charcot-Marie-Tooth (CMT) disease comprises a genetically and clinically heterogeneous group of peripheral nerve disorders characterized by impaired distal motor and sensory function. Mutations in three genes encoding aminoacyl-tRNA synthetases (ARSs) have been implicated in CMT disease primarily associated with an axonal pathology. ARSs are ubiquitously expressed, essential enzymes responsible for charging tRNA molecules with their cognate amino acids. To further explore the role of ARSs in CMT disease, we performed a large-scale mutation screen of the 37 human ARS genes in a cohort of 355 patients with a phenotype consistent with CMT. Here we describe three variants (p.Leu133His, p.Tyr173SerfsX7, and p.Ile302Met) in the lysyl-tRNA synthetase (KARS) gene in two patients from this cohort. Functional analyses revealed that two of these mutations (p.Leu133His and p.Tyr173SerfsX7) severely affect enzyme activity. Interestingly, both functional variants were found in a single patient with CMT disease and additional neurological and non-neurological sequelae. Based on these data, KARS becomes the fourth ARS gene associated with CMT disease, indicating that this family of enzymes is specifically critical for axon function.

Transcription of the prostate-specific antigen (PSA) gene is androgen regulated. The PSA promoter contains at position -170 the sequence AGAACAgcaAGTGCT, which is closely related to the ARE (androgen response element) consensus sequence GGTACAnnnTGTTCT. This sequence is a high affinity androgen receptor (AR) binding site and acts as a functional ARE in transfected LNCaP cells. A 35-base pair segment starting at -400 (ARR: androgen response region; GTGGTGCAGGGATCAGGGAGTCTCACAATCTCCTG) cooperates with the ARE in androgen induction of the PSA promoter. A construct with three ARR copies linked to a minimal PSA promoter showed a strong (104-fold) androgen induced activity. The ARR was also able to confer androgen responsiveness to a minimal thymidine kinase promoter. Both AR binding and transcriptional activity resided in a 20-base pair ARR subfragment: CAGGGATCAGGGAGTCTCAC (2S). Mutational analysis indicated that the sequence GGATCAgggAGTCTC in the 2S fragment is a functionally active, low affinity AR binding site. Like AR, the glucocorticoid receptor was able to stimulate PSA promoter activity. Both the ARE and ARR are involved in dexamethasone regulation of the PSA promoter. Both the AR and glucocorticoid receptor were 20-100-fold more active on ARR-PSA and ARR-thymidine kinase promoter constructs in LNCaP cells than in other cell types (COS, HeLa, Hep3B, and T47D cells), indicating (prostate) cell specificity.

Hereditary cutis laxa comprises a heterogeneous group of connective tissue disorders characterized by loose skin and variable systemic involvement. Autosomal dominant and recessive as well as X-linked forms have been described. Some dominant forms are caused by mutations in the elastine gene (ELN). The X-linked form is now classified in the group of copper transport diseases. The genetic defect underlying the autosomal recessive (AR) forms of cutis laxa is not known. The phenotypic abnormalities recently observed in a fibulin-5 knockout mouse model are reminiscent of human AR cutis laxa type I. Both share cutis laxa, lung emphysema and arterial involvement. Molecular study of the fibulin-5 (FBLN5) gene in a large consanguineous Turkish family with four patients affected by AR cutis laxa type I demonstrated the presence of a homozygous missense mutation (T998C) in the FBLN5 gene resulting in a serine-to-proline (S227P) substitution in the fourth calcium-binding epidermal growth factor-like domain of fibulin-5 protein. This amino acid substitution is predicted to have important structural and functional consequences for normal elastogenesis. As such, we provide evidence that a genetic defect in fibulin-5 (FBLN5, also known as EVEC or DANCE) is responsible for a recessive form of cutis laxa in humans.

Essentially all bacteria have genes for toxic metal ion resistances and these include those for Ag+, AsO2-, AsO4(3-), Cd2+ Co2+, CrO4(2-), Cu2+, Hg2+, Ni2+, Pb2+, TeO3(2-), Tl+ and Zn2+. The largest group of resistance systems functions by energy-dependent efflux of toxic ions. Fewer involve enzymatic transformations (oxidation, reduction, methylation, and demethylation) or metal-binding proteins (for example, metallothionein SmtA, chaperone CopZ and periplasmic silver binding protein SilE). Some of the efflux resistance systems are ATPases and others are chemiosmotic ion/proton exchangers. For example, Cd2+-efflux pumps of bacteria are either inner membrane P-type ATPases or three polypeptide RND chemiosmotic complexes consisting of an inner membrane pump, a periplasmic-bridging protein and an outer membrane channel. In addition to the best studied three-polypeptide chemiosmotic system, Czc (Cd2+, Zn2+, and Co2), others are known that efflux Ag+, Cu+, Ni2+, and Zn2+. Resistance to inorganic mercury, Hg2+ (and to organomercurials, such as CH3Hg+ and phenylmercury) involve a series of metal-binding and membrane transport proteins as well as the enzymes mercuric reductase and organomercurial lyase, which overall convert more toxic to less toxic forms. Arsenic resistance and metabolizing systems occur in three patterns, the widely-found ars operon that is present in most bacterial genomes and many plasmids, the more recently recognized arr genes for the periplasmic arsenate reductase that functions in anaerobic respiration as a terminal electron acceptor, and the aso genes for the periplasmic arsenite oxidase that functions as an initial electron donor in aerobic resistance to arsenite.