OBJECTIVE

The aim of this study was to evaluate performance of serum antibodies against deamidated gliadin peptides (a-DGPs) in detecting compliance with gluten-free diet (GFD) in children with celiac disease (CD).

METHODS

Serum samples were collected the same day of endoscopy in 95 children with CD and 106 controls. We preliminarily calculated the cutoff of a-DGP immunoglobulin A (IgA) and a-DGP IgA+G in our population by receiver operating characteristic (ROC) curves. Of 95 children with CD, 28 were studied during the first year after GFD introduction, with interview and serum collection every 3 months. In addition, serum samples were collected in 106 children with CD on GFD for more than 1 year (range 1-14). In both groups of children with CD on GFD, we compared a-DGP IgA and IgA+G performance in monitoring compliance with GFD with anti-tissue transglutaminase antibodies (anti-tTG) IgA and anti-gliadin antibody (AGA) IgA.

RESULTS

The cutoff resulted in 13.1 arbitrary units (AU) for a-DGP IgA (sensitivity 87.4, 95% confidence interval [CI] 79%-92%, specificity 97.2, 95% CI 92%-99%) and 16.5 for a-DGP IgA+G (sensitivity 94.7, 95% CI 88%-98%, specificity 89.6, 95% CI 84%-95%). In the first year of GFD, at 6 to 8 months prevalence of positive a-DGPs was significantly higher in partially versus strictly compliant children, and at 9 to 12 months only prevalence of positive a-DGP IgA+G remained significantly higher. Moreover, at 9 to 12 months sensitivity to detect transgressions to GFD was 44% for a-DGP IgA and 100% for a-DGP IgA+G (P = 0.03). In the 106 children on GFD for more than 1 year, sensitivity to detect transgressions to GFD was 60% for a-DGP IgA and 76% for a-DGP IgA+G. Anti-tTG IgA and AGA IgA sensitivity was much lower (24% and 4%, respectively). The 4 tests showed comparable high specificity.

CONCLUSIONS

Both a-DGPs showed higher sensitivity than anti-tTG IgA and AGA IgA in monitoring compliance with GFD, but a-DGP IgA+G seemed to perform better. a-DGPs did not outperform anti-tTG IgA for CD screening.

In celiac disease (CD), gluten, the disease-inducing toxic component in wheat, induces the secretion of IgA-class autoantibodies which target tissue transglutaminase (tTG). These autoantibodies are produced in the small-intestinal mucosa, and, during gluten consumption, they can also be detected in patients' serum but disappear slowly from the circulation on a gluten-free diet. Interestingly, after adoption of a gluten-free diet the serum autoantibodies disappear from the circulation more rapidly than the small-intestinal mucosal autoantibody deposits. The finding of IgA deposits on extracellular tTG in the liver, kidney, lymph nodes and muscles of patients with CD indicates that tTG is accessible to the gut-derived autoantibodies. Although the specific autoantibody response directed against tTG is very characteristic in celiac patients, their role in the immunopathology of the celiac mucosal lesion is a matter of debate. Here we report a brief summary of anti-tTG antibody effects demonstrating that these antibodies are functional and not mere bystanders in the disease pathogenesis. In fact, they inhibit intestinal epithelial cell differentiation, induce intestinal epithelial cell proliferation, increase epithelial permeability and activate monocytes and disturb angiogenesis.

OBJECTIVE

In China, epidemiologic information on celiac disease autoimmunity is scarce and fragmented. We investigated the prevalence of celiac disease autoimmunity in the general Chinese population.

METHODS

In a cross-sectional prospective study, 19,778 undiagnosed Chinese adolescents and young adults (age, 16-25 y) were recruited from consecutive new students who underwent routine physical examinations at 2 universities in Jiangxi, China, from September 2010 through October 2013; the students were from 27 geographic regions in China. All subjects were tested for serum IgG, IgG against deamidated gliadin peptides (IgG anti-DGP), and IgA anti-tissue transglutaminase antibodies (IgA anti-tTG). We also analyzed HLA genotypes in subgroups of participants with different results from tests for serum markers of celiac disease.

RESULTS

A total of 434 students (2.19%) tested positive for serum markers for celiac disease (95% confidence interval [CI], 1.99%-2.41%), 0.36% of the students tested positive for anti-tTG IgA (95% CI, 0.28%-0.46%), and 1.88% tested positive for anti-DGP IgG (95% CI, 1.70%-2.09%). The prevalence of celiac disease autoimmunity (positive results in assays for anti-tTG IgA and anti-DGP-IgG) was 0.06% (95% CI, 0.03%-0.10%). Celiac disease autoimmunity was associated with the consumption of wheat and female sex. The prevalence in the Shandong province in north China, where wheat is a staple in the diet, was 0.76% (95% CI, 0.21%-1.95%). The frequencies of the HLA-DQ2/-DQ8 genotypes associated with celiac disease were higher in subjects with celiac disease autoimmunity, based on detection of both serum markers, than in subjects with positive results from a single test (P < .01). All subjects with positive results from both assays carried the HLA-DQ2 genotype.

CONCLUSIONS

Approximately 2% of adolescents or young adults in China had positive results from assays for serum markers for celiac disease. The prevalence of celiac disease autoimmunity in the Shandong province in north China, where wheat is a staple in the diet, was 0.76%.

BACKGROUND

Pure oats are safe for most patients with celiac disease, but concerns regarding contamination by other grains limit their consumption. The Canadian Celiac Association recently released guidelines governing the production of pure oats. The objective was to test the safety of a product manufactured under these guidelines.

METHODS

Fifteen adults with established, biopsy-confirmed celiac disease of ≥ 1 year duration were challenged with 350 g/wk of pure oats for 12 weeks. Symptom scores, weight, hemoglobin, ferritin, albumin, and tissue transglutaminase (tTG) were assessed at weeks 0, 6, and 12. Duodenal biopsies were obtained before and after oat challenge and assessed based on the modified Marsh-Oberhuber score. Compliance with a gluten-free diet was monitored with random food diaries.

RESULTS

Fifteen patients completed the study and were analyzed in intention-to-treat and per-protocol analyses. There were no significant changes in symptom scores, weight, hemoglobin, ferritin, or albumin during oat consumption. The tTG remained negative in all patients, and the histology scores did not significantly change during oat challenge. The only relapse occurred in a patient who became noncompliant with her gluten-free diet.

CONCLUSIONS

The findings support the safety of pure, uncontaminated oats manufactured under Canadian Celiac Association guidelines for patients with celiac disease.

OBJECTIVE

To determine the prevalence of antibodies associated with celiac disease and biopsy-proven celiac disease in children with autoimmune thyroid disease.

METHODS

A total of 302 patients with positive anti-thyroid antibodies were prospectively studied. Total immunoglobulin A (IgA) and tissue transglutaminase-IgA (tTG-IgA) levels were obtained. Those with a positive tTG-IgA titer were offered biopsy for definitive diagnosis of celiac disease.

RESULTS

A total of 4.6% of subjects with autoimmune thyroid disease had positive tTG-IgA titers. The prevalence of biopsy-confirmed celiac disease was 2.3%. Our population was enriched with patients with type 1 diabetes mellitus (4.3%) and Down syndrome (3.4%). Excluding individuals with these co-morbidities, the prevalence of celiac disease in autoimmune thyroid disease is 1.3%, similar to that of the general population. The positive predictive value of biopsy-proven celiac disease in patients with autoimmune thyroid disease and positive tTG-IgA titer was 54%.

CONCLUSIONS

The increase in prevalence of celiac disease in autoimmune thyroid disease in our study was largely caused by enrichment with co-morbidities. Without comorbidities or symptoms, screening for celiac disease may not be justified in this population. The specificity of tTG-IgA titer for the diagnosis of celiac disease was decreased in patients with autoimmune thyroid disease compared with the general population.

BACKGROUND

For rare and novel RET mutations associated with hereditary medullary thyroid carcinoma (MTC), clinical and functional studies are needed to classify the RET mutation into one of the three clinical risk groups.

OBJECTIVE

We analyzed proliferative properties and clinical implications associated with the RET protooncogene transmembrane domain mutation S649L.

METHODS

The transforming potential and mitogenic properties of S649L mutation were investigated clinically and by evaluating kinase activity, cell proliferation, and colony formation.

METHODS

Fifteen individuals from five kindreds were identified as carriers of a RET protooncogene mutation in exon 11 codon 649 (TCG(Ser)->>TTG(Leu)). In two out of five index patients, a second RET mutation (C634W or V804L) was detected.

RESULTS

Eight gene carriers were operated on. Histology revealed MTC and C-cell hyperplasia in three index and three screening patients respectively. In all other gene carriers (aged 41-64 years), calcitonin levels were in the normal range, and pentagastrin-stimulated calcitonin levels were <100 pg/ml. Therefore, thyroidectomy had not yet been performed. In one index patient carrying the S649L mutation, hyperparathyroidism was confirmed histologically. RET S649L-expressing NIH3T3 cells exhibited a clear increase of phosphotyrosine and proliferation rate when compared with parental NIH3T3 cells but a significantly lower kinase activity and cell growth rate when compared with RET C634R-expressing cells. When compared with RET C634R, the S649L mutant showed moderate transforming potential with small-sized colonies.

CONCLUSIONS

Our clinical and in vitro findings indicate that the transmembrane RET S649L mutation is associated with late-onset non-aggressive disease. Recommendations for prophylactic thyroidectomy should be individualized depending on stimulated calcitonin levels.

Tissue transglutaminase (tTG) is an indicator of acute cell death in vitro. An increase in tTG protein level is found in postmortem Alzheimer's disease (AD) brains as well as in Huntington's disease. No study revealed tTG in vivo so far. We investigated the concentrations of tTG in the cerebrospinal fluid (CSF) obtained from 84 patients using ELISA assays. We compared 33 patients with probable AD to 18 patients with probable vascular dementia (VaD) and 33 control patients without neuropsychological deficit. Diagnosis was supported by CSF parameter and neuroimaging. We found a highly significant difference (P = 0.001) between the concentration of tTG in the AD groups (7.58 pg/ml) and controls (2.99 pg/ml). There was no statistical difference between controls and VaD (2.93 pg/ml). Interestingly, tTG did not show an association with tau protein, Abeta42, apoE4, neuropsychological items, or age. Males showed lower tTG values than females; however, this difference did not reach statistical significance. To our knowledge, this is the first demonstration that tTG is increased in AD in vivo. Our results suggest that tTG may be a powerful biochemical marker of the acute degenerating process in vivo. It may serve as completion of CSF analysis in the diagnosis of dementing disorders and may be a simple way of assessing the efficacy of possible new antiapoptotic drugs.

BACKGROUND

This study was done to evaluate the diagnostic utility of antibodies against deamidated gliadin peptides compared to traditional markers for coeliac disease.

OBJECTIVE

To evaluate diagnostic utility of antibodies against deamidated gliadin peptide (DGP).

METHODS

Sera from 176 adults, referred for endoscopy without previous analysis of antibodies against tissue transglutaminase (tTG) or endomysium (EmA), were retrospectively analysed by ELISAs detecting IgA/IgG antibodies against DGP or a mixture of DGP and tTG, and compared with IgA-tTG and EmA. Seventy-nine individuals were diagnosed with coeliac disease.

RESULTS

Receiver operating characteristic analyses verified the manufacturers' cut-off limits except for IgA/IgG-DGP/tTG. In sera without IgA deficiency, the sensitivity was higher for IgA/IgG-DGP (0.85-0.87) compared with IgA-tTg (0.76) and EmA (0.61). All tests showed high specificity (0.95-1.00). Eighteen coeliac disease-sera were negative regarding IgA-tTG, nine of which were positive for IgA/IgG-DGP. Sera from coeliac disease-patients >70 years were more often negative for IgA-tTG (50%) and IgA/IgG-DGP (36%) than younger patients (15% and 8% respectively) (P < 0.01). Three of the four IgA-deficient patients were positive in the IgA/IgG-DGP assay.

CONCLUSIONS

In this study of patients unselected regarding IgA-tTg/EmA, thus unbiased in this respect, IgA/IgG-DGP identified adult coeliac disease patients negative for antibodies against endomysium and tissue transglutaminase. Serology is often negative in elderly patients with coeliac disease; a small bowel biopsy should therefore be performed generously before coeliac disease is excluded.

BACKGROUND

Autoantibodies are often produced during infection with chronic hepatitis C virus (HCV), but it remains controversial whether they influence the biochemical profile and histological features of this disease. Therefore, this current study sought to describe these autoantibodies and evaluate their impact on the clinical and histological presentation of hepatitis C.

METHODS

This cross-sectional analytical study assessed patients with HCV (RNA+) from October 2011 to July 2012.

RESULTS

This study included 66 patients, with a mean age of 53.2±10.5 years. Of these patients, 60.6% were male, and 54.3% presented with genotype 1. Non-organ-specific autoantibodies (NOSA) were detected in 24% of the patients; of these, 7.6% were anti-mitochondrial antibodies (AMA+), 26.7% were anti-smooth muscle antibodies (SMA+) and 6.8% were liver kidney microsomal type 1 antibodies (LKM1+). With respect to the thyroid autoantibodies, 7.4% were anti-peroxidase (ATPO+) antibodies, and none were anti-thyroglobulin (ATG+) antibodies. Regarding celiac disease autoantibodies, 5.8% were endomysial antibodies (EMA+), and no transglutaminase (TTG+) antibodies were detected. Cryoglobulins were found in 2.1% of patients. When NOSA+ individuals were compared to patients without the presence of NOSAs, they exhibited higher median alkaline phosphatase (0.7 vs. 0.6 xULN; p=0.041), lower median platelet counts (141,500.0 vs. 180,500.0/mm 3 ; p=0.036), lower mean prothrombin activity (72.6±11.5% vs. 82.2±16.0%; p=0.012) and an increased prevalence of significant fibrosis (E≥2) (45.5% vs. 18.2%; p=0.012). There was also a tendency for a greater proportion of NOSA+ cases to have marked periportal activity (APP≥3) (44.5% vs. 15.6%; p=0.087).

CONCLUSIONS

In addition to the high prevalence of autoantibodies associated with HCV infection, it was observed that NOSA positivity was associated with a more severe histological and biochemical profile of hepatitis C infection.

BACKGROUND

A defect in hypothalamic-pituitary-adrenal (HPA) axis function has been suggested to contribute to susceptibility to rheumatoid arthritis (RA).

OBJECTIVE

To investigate polymorphisms of the glucocorticoid receptor (GR) gene and determine any associations with RA.

METHODS

Three GR polymorphisms that tag 95% of all haplotypes across the GR gene were genotyped. These are an intron B Bcl1 polymorphism, a ttg insertion/deletion within intron F (rs2307674) and the single nucleotide polymorphism (SNP) lying in the 3' untranslated region of exon 9b (rs6198). The dye terminator-based SNaPshot method or size resolution by capillary electrophoresis was performed. The study population comprised 198 UK Caucasian RA cases and 393 ethnically matched controls.

RESULTS

No significant single point or haplotypic associations were found for GR polymorphisms with RA susceptibility. Furthermore, no evidence for GR polymorphisms with aspects of RA severity was seen.

CONCLUSIONS

In this study of the most comprehensive coverage of GR polymorphisms with RA, no significant contributing role for GR polymorphisms with RA was found.

OBJECTIVE

In children with type 1 diabetes mellitus (T1DM), elevated levels of antitissue transglutaminase (anti-tTG) antibody may spontaneously normalize, despite continued consumption of gluten. We aimed to investigate the prevalence of spontaneous normalization of anti-tTG levels and the existence of factors predictive for this outcome.

METHODS

All children referred from 2002 to 2012 were screened for celiac disease (CD) at diabetes onset and at specific intervals. In the presence of a high anti-tTG titer or clinical symptoms, children were offered endoscopy, and asymptomatic patients with a low anti-tTG titer were invited to a second serological test after 6 months of eating a gluten-containing diet.

RESULTS

The study included 446 children. Of these, 65 (14.5%) became positive for celiac serology: 38 (58%) had a persistently elevated anti-tTG titer and 27 (41%) fluctuating anti-tTG titer; 18 (28%) became negative. The prevalence of positive CD autoimmunity and overt CD was 14.3% (95% CI 11-17) and 8.5% (95% CI 5-10), 15- and 8-times higher than the general pediatric population, respectively. Asymptomatic children older than 9.1 years at T1DM onset had the lowest risk to develop CD.

CONCLUSIONS

Serum anti-tTG levels decreased spontaneously in 40% of children with T1DM and became negative in 20%, despite gluten consumption. This finding supports the hypothesis of a state of temporary positivity of celiac serology in children with diabetes. In absence of clinical symptoms or signs of CD, histological confirmation of the disease and the gluten-free diet should be postponed to avoid unnecessary procedures and reduce an additional psychological burden.

Brain microbleeds often occur in Alzheimer's disease patients. Our previous studies have demonstrated that iron contributes to brain injury following intracerebral hemorrhage. This study investigated the effect of iron on amyloid β (Aβ)-mediated brain injury. There were two parts to this study. In first part, rats received an intracaudate injection of saline, iron, Aβ 25-35 or iron+Aβ 25-35. In the second part, rats received intracaudate injection of iron+Aβ and were treated with saline or cystamine, an inhibitor of transglutaminase. Rats were killed after 24 hours for brain edema measurement. DNA damage, neuronal death and tissue-type transglutaminase (tTG) expression were also examined. We found that brain water content in the ipsilateral caudate was higher (p<0.05) in rats injected with iron+Aβ than with iron, Aβ or saline. Combined iron+Aβ injection also resulted in more severe DNA damage (both single- and double-strand; p<0.01) and more Fluoro-Jade C staining (p<0.05). Expression of tTG increased markedly in the iron+Aβ group (p<0.05) and treatment with a tTG inhibitor reduced brain edema (p<0.05) and reduced degenerating neurons (124±25 vs. 249±50/mm(2) in vehicle-treated group, p<0.05). These results suggest that increased brain iron from microbleeds may exaggerate brain Aβ toxicity and that tTG is involved in the enhanced toxicity.

Neurodegeneration occurs after intracerebral hemorrhage (ICH) and tissue-type transglutaminase (tTG) has a role in neurodegenerative disorders. The present study investigated tTG expression after ICH and the effects of a tTG inhibitor, cystamine, on ICH-induced brain edema and neurological deficits. This study has two parts. In the first, male Sprague-Dawley rats received an intracaudate injection of 100 microL autologous whole blood or a needle insertion (sham). Rats were killed 3 days later and the brains used for immunohistochemistry, Western blots and real-time quantitative polymerase chain reaction. In the second set, ICH rats were treated intraperitoneally with either a tTG inhibitor, cystamine, or vehicle. Rats underwent behavioral testing and were killed at day-3 for measurement of brain swelling. tTG positive cells were found in the ipsilateral basal ganglia after ICH and most of those cells were neuron-like. Western blot analysis showed a 3-fold increase in tTG in the ipsilateral basal ganglia (p<0.01 vs. sham) after ICH. tTG mRNA levels were also significantly higher (8.5-fold increase vs. sham). Cystamine treatment attenuated ICH-induced brain swelling (day 3: 14.4+/-3.2 vs. 21.4+/-4.0% in vehicle-treated rats, p<0.01), neuronal death and improved functional outcome (forelimb placing score: 47+/-23 vs. 17+/-16% in vehicle-treated rats, p<0.05). ICH induces perihematomal tTG upregulation and cystamine, a tTG inhibitor, reduces ICH-induced brain swelling and neurological deficits.

Tissue transglutaminase (tTG) is a multifunctional enzyme that catalyzes peptide cross-linking and polyamination reactions, and also is a signal-transducing GTPase. tTG protein content and enzymatic activity are upregulated in the brain in Huntington's disease and in other neurological diseases and conditions. Since mouse models are currently being used to study the role of tTG in Huntington's disease and other neurodegenerative diseases, it is critical that the level of its expression in the mouse forebrain be determined. In contrast to human forebrain where tTG is abundant, tTG can only be detected in mouse forebrain by immunoblotting a GTP-binding-enriched protein fraction. tTG mRNA content and transamidating activity are approximately 70% lower in mouse than in human forebrain. However, tTG contributes to the majority of transglutaminase activity within mouse forebrain. Thus, although tTG is expressed at lower levels in mouse compared with human forebrain, it likely plays important roles in neuronal function.

Tissue-type transglutaminase (tTG, EC 2.3.2.13) has been implicated in various disease paradigms including neurodegenerative disease. In these studies, tTG induction after traumatic brain injury was studied using a rat cortical impact model. Using western blots, two forms of tTG protein expression were identified--an approximately 79-kDa primary form (tTG-L) and a less abundant approximately 70-kDa form (tTG-S). Both forms of tTG protein were elevated after injury. In ipsilateral cortex, peak induction of tTG-L protein [561% +/- 80% of control (n = 5)] was observed five days after injury, with expression remaining elevated after two weeks. Peak induction of tTG-S protein [302% +/- 81% of control (n = 5)] was observed three days after injury. Lesser tTG protein induction was observed in hippocampus. Northern blot analysis demonstrated two tTG transcripts in the ipsilateral cortex with peak induction of tTG-L mRNA three days after injury. However, tTG-S mRNA was not identified in control samples and only faintly detected in injured tissue. To facilitate analysis of low abundance transcripts in smaller tissue samples, a semiquantitative real-time PCR strategy was used. Semi-quantitative PCR analysis of tTG-L mRNA induction in ipsilateral cortex (peak after three days; 414% +/- 21% of control, n = 3) confirmed tTG-L mRNA induction determined by northern blot (410% of control).

Tissue transglutaminase (tTG) is activated during the apoptotic cell death cascade and plays a key role in the formation of apoptotic bodies. We found significant elevation of tTG concentration in the cerebrospinal fluid (CSF) of 54 patients with Parkinson's disease (PD) compared with that measured in 34 control subjects, thus showing increased neural cell apoptosis in patients with PD.

Temperate Bacillus subtilis phage SPO2 codes for a phage-specific DNA polymerase. The polymerase gene has been cloned, and its nucleotide sequence has been determined. Within the sequence there is an open reading frame starting with a TTG and ending with three consecutive translational stop codons. Ten base pairs upstream from the proposed TTG initiation codon there is a probable ribosome-binding site with a calculated free energy of interaction with the 3' end of B. subtilis 16S rRNA of -15 kcal (-63 kJ)/mol. Based on the sequence and the expression of the polymerase gene in three different hybrid plasmids, we conclude that this open reading frame is the structural gene for SPO2 DNA polymerase. The predicted molecular weight of the polymerase is 72,486. In hybrid plasmid pJB74, the terminal triplet of an open reading frame with coding capacity for a protein of ca. 10 kilodaltons overlaps with the translational initiation triplet TTG of the polymerase gene. We speculate that transcription and translation of this open reading frame can influence the amount of phage DNA polymerase made in SPO2-infected bacteria.

BACKGROUND

Endomysial antibody (EMA) and tissue transglutaminase (tTG) antibody testing is used to screen subjects with suspected celiac disease. However, the traditional gold standard for the diagnosis of celiac disease is histopathology of the small bowel. As villous atrophy may be patchy, duodenal biopsies could potentially miss the abnormalities. Capsule endoscopy can obtain images of the whole small intestine and may be useful in the early diagnosis of celiac disease.

OBJECTIVE

To evaluate suspected celiac disease patients who have positive celiac serology and normal duodenal histology and to determine, with capsule endoscopy, whether these patients have any endoscopic markers of celiac disease.

METHODS

Twenty-two subjects with positive celiac serology (EMA or tTG) were prospectively evaluated. Eight of the subjects had normal duodenal histology and 14 had duodenal histology consistent with celiac disease. All subjects underwent capsule endoscopy. Endoscopic markers of villous atrophy such as loss of mucosal folds, scalloping, mosaic pattern, and visible vessels were assessed.

RESULTS

Eight subjects with normal duodenal histology had normal capsule endoscopy findings. In the 14 subjects with duodenal histology that was consistent with celiac disease, 13 had celiac disease changes seen at capsule endoscopy. One subject with normal capsule endoscopy findings showed Marsh IIIc on duodenal histology. Using duodenal histology as the gold standard, capsule endoscopy had a sensitivity of 93%, specificity of 100%, PPV of 100%, and NPV of 89% in recognizing villous atrophy.

CONCLUSIONS

Capsule endoscopy is useful in the detection of villous abnormalities in untreated celiac disease. Patients with positive celiac serology (EMA or tTG) and normal duodenal histology are unlikely to have capsule endoscopy markers of villous atrophy.

Azorhizobium caulinodans ORS571, a bacterium capable of nodulating roots and stems of the tropical legume Sesbania rostrata, has been shown to have no nodD-like gene located immediately upstream from its common nodABC locus. A clone carrying a functional nodD gene of strain ORS571 has now been isolated from a pLAFR1 gene library by screening for naringenin-induced expression of the common nod genes in an Agrobacterium background. Tn5 mutagenesis of the cloned insert DNA delimited the inducing activity to a +/- 0.8-kilobase-pair fragment. One of the Tn5 insertions in the activator locus was homogenotized in the ORS571 genome. This resulted in a mutant strain (ORS571-3) that was unable to induce common nod gene expression in the presence of host plant exudate or the flavanone naringenin and that had lost the capacity to nodulate the roots and stems of S. rostrata. Complementation of both mutant phenotypes was achieved upon introduction of the cloned nodD gene. Sequencing of the nodD locus indicated the presence of a single, 942-base-pair-long open reading frame (ORFD) with significant homology to the nodD gene of (brady)rhizobia. The level of homology, however, is the lowest thus far reported for this kind of gene. ORFD most likely initiates translation with a TTG start codon. Upstream from ORFD, a divergently oriented nod box-like sequence is present, the function of which remains to be determined.

T-cell immunoglobulin- and mucin-domain-containing molecule 3 (TIM-3) is a novel transmembrane protein that is involved in the regulation of T-helper 1 (Th1)-cell-mediated immunity. This study was undertaken to investigate the association of TIM-3 polymorphisms with susceptibility to renal cell carcinoma (RCC) in the Chinese population. Blood was collected from 322 RCC patients and 402 healthy controls. Three polymorphisms in the TIM-3 gene (-1516G/T, -574G/T, and +4259T/G) were genotyped by polymerase chain reaction-restriction fragment length polymorphism. Results showed that the -574G/T and +4259T/G polymorphisms were significantly increased in the RCC cases (odds ratio [OR] = 2.77, 95% confidence interval [CI], 1.42-5.39, p = 0.002 and OR = 3.22, 95% CI, 1.64-6.35, p<0.001). When analyzing the haplotypes of TIM-3 polymorphisms, TTG (-1516, -574, and +4259) revealed a significant correlation with RCC (OR = 3.55, 95% CI, 1.13-11.2, p = 0.033). In addition, the prevalence of +4259T/G polymorphism was higher in RCC cases with metastasis than in those without metastasis (7.4% vs. 3.5%, p = 0.041). These results suggest that polymorphisms in the TIM-3 gene are new risk factors for RCC and that TIM-3 may play important roles in regulating the prognosis of this disease.

Immunoscreening of a lambda gt11 genomic library of Borrelia burgdorferi expressed in Escherichia coli permitted detection of a clone containing a partial sequence of a B. burgdorferi gene encoding a protein with significant homology to TmpC of Treponema pallidum. Subsequent cloning and DNA sequence analysis revealed an open reading frame encoding a protein with 353 amino acid residues. The open reading frame is preceded by putative promoter sequences and a ribosome binding site, and is initiated with a TTG. The putative protein shares 26% identity with TmpC, contains a signal peptidase II sequence, and is also homologous to the gene products of the recently described bmpA and bmpB of B. burgdorferi. This gene has been designated bmpC. Additional sequencing and restriction analysis indicate that it is located at approximately 400 kbp on the chromosomal map of B. burgdorferi, immediately upstream of bmpA and bmpB.

Celiac disease (CD) is an autoimmune disorder of the small intestine triggered by environmental factors in genetically predisposed individuals. A strong association between type 1 diabetes (T1DM) and CD has been reported. We have previously shown that rotavirus infection may be involved in the pathogenesis of CD through a mechanism of molecular mimicry. Indeed, we identified a subset of anti-transglutaminase IgA antibodies that recognize the rotavirus viral protein VP7. In this study, we aimed at evaluating whether such antibodies may predict the onset of CD in children affected by T1DM. Moreover, to further analyze the link between rotavirus infection and pathogenesis of CD, we analyzed the effect of anti-rotavirus VP7 antibodies on T84 intestinal epithelial cells using the gene-array technique, complemented by the analysis of molecules secreted in the supernatant of stimulated cells. We found that anti-rotavirus VP7 antibodies are present in the vast majority (81%) of T1DM-CD tested sera, but are detectable also in a fraction (27%) of T1DM children without CD. Moreover, we found that anti-rotavirus VP7 antibodies are present before the CD onset, preceding the detection of anti-tTG and anti-endomysium antibodies. The gene-array analysis showed that purified anti-rotavirus VP7 antibodies modulate genes that are involved in apoptosis, inflammation, and alteration of the epithelial barrier integrity in intestinal epithelial cells, all typical features of CD. Taken together, these new data further support the involvement of rotavirus infection in the pathogenesis of CD and suggest a predictive role of anti-rotavirus VP7 antibodies.

BACKGROUND

Since the identification of tissue transglutaminase (tTG) as the antigen for the anti-endomysial antibodies (EMA), several antigen-specific immunoassays have been reported for celiac disease (CD) screening. A first objective was to evaluate the suitability for CD screening of three different IgA tTG ELISAs, two of them based on guinea pig liver tTG (gp-tTG) (an in-house ELISA with a partially purified extract and a commercial ELISA with purified gp-tTG antigen) and a third recombinant human tTG (rh-tTG) ELISA. The results are compared with EMA and with the final clinical diagnosis. A second objective was to analyze antibody reactivities in those patients with anti-tTG and EMA discrepancies.

METHODS

ELISA and EMA tests were used to measure IgA anti-tTG levels in sera from 259 patients (107 had CD and 72 had Type I diabetes mellitus).

RESULTS

The purified gp-tTG ELISA was highly sensitive (97.7%) and specific (98.8%) in the detection of CD, almost equaling EMA. Rh-tTG ELISA did not improved the sensitivity of EMA, but its specificity was slightly superior. Immunoblot analysis with partially purified gp-tTG extract, the antigen most frequently used for anti-tTG detection, showed that the majority of false positives were due to IgA reactivities to contaminant proteins present in the liver antigenic extract. This low specificity was particularly problematic in diabetics.

CONCLUSIONS

Purified tTG ELISAs, either with purified guinea pig liver or recombinant human antigens, can be used as quantitative and observer-independent alternatives to the traditional and time-consuming EMA in the screening of CD.

Little is known about the regulation of the DNA damage-mediated gene expression in archaea. Here we report that the addition of actinomycin D to Sulfolobus solfataricus cultures triggers the expression of the radA paralogue sso0777. Furthermore, a specific retarded band is observed when electrophoretic mobility shift assays (EMSAs) with crude S. solfataricus cell extracts and the sso0777 promoter were carried out. The protein that binds to this promoter was isolated and identified as Sta1. Footprinting experiments have shown that the Sta1 DNA-binding site is included in the ATTTTTTATTTTCACATGTAAGATGTTTATT sequence, which is located upstream the putative TTG translation starting codon of the sso0777 gene. Additionally, gel electrophoretic mobility retardation experiments using mutant sso0777 promoter derivatives show the presence of three essential motifs (TTATT, CANGNA and TTATT) that are absolutely required for Sta1 DNA binding. Finally, in vitro transcription experiments confirm that Sta1 functions as an activator for sso0777 gene expression being the first identified archaeal regulatory protein associated with the DNA damage-mediated induction of gene expression.