The anatomical relation between a malignant tumor and its vascular and lymphatic bed is an important factor influencing metastasis. Lack of specific markers for the lymphatic endothelium has long hampered a reliable detection of lymphatics. Here, we demonstrate that lymphatic endothelium can reliably be identified in a panel of different normal tissues and of benign and malignant tumors. Application of the previously described PAL-E/CD31 double staining protocol differentiates between blood capillaries and veins on one hand and lymphatic vessels on the other. Blood vessel marker CD34, absent from lymphatics, was used additionally to classify arteries. We found that the lymphatic vascular endothelial growth factor receptor-3 (VEGFR-3, also known as Flt-4) was present on both lymphatic and blood vessels in 76 of 113 malignant tumors [adenocarcinoma of kidney (n = 3), colon (n = 3) and liver (n = 3), breast (n = 9) and squamous cell carcinoma (n = 5), primary (n = 81), and metastatic (n = 9) melanoma]. No evident signs of tumor-induced lymphangiogenesis were observed. Evaluation of a series of 110 melanocytic skin lesions indicated that VEGFR-3 expression is confined to the lymphatic vasculature in benign lesions. However, its expression emerges on the blood neovasculature in malignant lesions as soon as metastatic potential develops. We conclude that induction of VEGFR-3 expression on tumor blood vessels may be a general phenomenon that would make VEGFR-3 a marker for tumor endothelium. In addition, we propose VEGFR-3 expression as a new microvascular progression marker in cutaneous melanoma.

The committed biosynthetic reaction to benzoyl-coenzyme A in the marine bacterium "Streptomyces maritimus" is carried out by the novel prokaryotic phenylalanine ammonia lyase (PAL) EncP, which converts the primary amino acid L-phenylalanine to trans-cinnamic acid. Recombinant EncP is specific for L-phenylalanine and shares many biochemical features with eukaryotic PALs, which are substantially larger proteins by approximately 200 amino acid residues.

Mutations are the fundamental source of biological variation, and their rate is a crucial parameter for evolutionary and medical studies. Here we used whole-genome sequence data from 753 Icelandic males, grouped into 274 patrilines, to estimate the point mutation rate for 21.3 Mb of male-specific Y chromosome (MSY) sequence, on the basis of 1,365 meioses (47,123 years). The combined mutation rate for 15.2 Mb of X-degenerate (XDG), X-transposed (XTR) and ampliconic excluding palindromes (rAMP) sequence was 8.71 × 10(-10) mutations per position per year (PPPY). We observed a lower rate (P = 0.04) of 7.37 × 10(-10) PPPY for 6.1 Mb of sequence from palindromes (PAL), which was not statistically different from the rate of 7.2 × 10(-10) PPPY for paternally transmitted autosomes. We postulate that the difference between PAL and the other MSY regions may provide an indication of the rate at which nascent autosomal and PAL de novo mutations are repaired as a result of gene conversion.

Phenylalanine ammonia-lyase (PAL) catalyzes the first rate-limiting step in the phenylpropanoid pathway, which controls carbon flux to a variety of bioactive small-molecule aromatic compounds, and to lignin, the structural component of the cell wall. PAL is regulated at both the transcriptional and translational levels. Our knowledge about the transcriptional regulation of PAL is relatively comprehensive, but our knowledge of the molecular basis of the posttranslational regulation of PAL remains limited. Here, we demonstrate that the Arabidopsis thaliana Kelch repeat F-box (KFB) proteins KFB01, KFB20, and KFB50 physically interact with four PAL isozymes and mediate their proteolytic turnover via the ubiquitination-26S proteasome pathway. The KFB genes are differentially expressed in Arabidopsis tissues and respond to developmental and environmental cues. Up- or downregulation of their expression reciprocally affects the stability of the PAL enzymes, consequently altering the levels of phenylpropanoids. These data suggest that the KFB-mediated protein ubiquitination and degradation regulates the proteolysis of PALs, thus posttranslationally regulating phenylpropanoid metabolism. Characterizing the KFB-mediated proteolysis of PAL enzymes may inform future strategies for manipulating the synthesis of bioactive phenolics.

OBJECTIVE

The vascular endothelial growth factor (VEGF) family is involved in vascular leakage and angiogenesis in diabetic retinopathy (DR) in the eye, but may also have physiological functions. Based on the hypothesis that differential VEGF receptor (VEGFR) expression in the retina is an important determinant of effects of VEGF, this study was conducted to investigate VEGFR expression in the diabetic retina and in an experimental monkey model of VEGF-A-induced retinopathy.

METHODS

In retinas of 27 eyes of diabetic donors, 18 eyes of nondiabetic control donors, and 4 monkey eyes injected with PBS or VEGF-A, expression patterns of VEGFR-1, -2, and -3 in relation to leaky microvessels, as identified by the marker pathologische anatomie Leiden-endothelium (PAL-E) were studied by immunohistochemistry. RESULTS. In control human retinas and retinas of PBS-injected monkey eyes, all three VEGFRs were expressed in nonvascular areas, but only VEGFR-1 was constitutively expressed in retinal microvessels. In diabetic eyes, increased microvascular VEGFR-2 expression was found in association with PAL-E expression, whereas microvascular VEGFR-3 was present in a subset of PAL-E-positive cases. In VEGF-A-injected monkey eyes, VEGFR-1, -2, and -3 and PAL-E were expressed in retinal microvessels.

CONCLUSIONS

The VEGFR-1, -2, and -3 expression patterns in control retinas suggest physiological functions of VEGFs that do not involve the vasculature. Initial vascular VEGF signaling may act primarily through VEGFR-1. In diabetic eyes, expression of retinal VEGFR-2 and -3 is increased, mainly in leaky microvessels, and VEGF-A induces vascular expression of the VEGF-A receptor VEGFR-2 and the VEGF-C/D receptor VEGFR-3. These findings indicate a dual role of VEGFs in the physiology and pathophysiology of the retina and suggest that microvascular VEGFR-2 and -3 signaling by VEGFs occurs late in the pathogenesis of DR, possibly initiated by high levels of VEGF-A in established nonproliferative DR.

We have investigated the expression of a gene that codes for a glycine-rich structural protein (GRP1) in petunia. This gene is expressed as a single polyadenylated RNA of approximately 1,600 bases which was found to be present in leaves, stems, and flowers of petunia but not in roots. In the organs in which GRP1-specific mRNA was expressed, its steady-state levels were highest in stems and leaves and lowest in flowers. This analysis also revealed that the pattern of organ-specific expression for several of the GRP1-related genes was distinctly different. In addition, it was found that the levels of GRP1 RNA were significantly higher in young leaves and stems than in old, implying developmental regulation of the gene. GRP1-specific RNA in both old and young tissue that had been wounded was found to be increased at least 25-fold over that in young unwounded tissue. Increased levels of GRP1 mRNA were seen within 5 min after wounding, with substantial increases apparent by 30 min. Maximal levels of accumulation of GRP1 transcripts occurred 90 min after wounding. The enhancement of GRP1 mRNA levels by wounding appears to be one of the earliest events of the plant wound response and is distinct from that which we observed for the PAL gene in petunia. Using S1 analysis and RNA primer extension, we demonstrated that the same transcriptional start site was used by the GRP1 gene in all organs and in wounded and unwounded tissue. The potential significance of these data with regard to wound signal transduction is discussed.

Lignin and lignans share monolignols as common precursors and are both potentially involved in plant defence against pathogens. In this study, we investigated the effects of fungal elicitors on lignin and lignan metabolism in flax (Linum usitatissimum) cell suspensions. Cell suspension cultures of flax were treated with elicitor preparations made from mycelium extracts of Botrytis cinerea, Phoma exigua and Fusarium oxysporum F ssp lini. Elicitors induced a rapid stimulation of the monolignol pathway, as confirmed by the increase in PAL (phenylalanine ammonia-lyase, EC 4.1.3.5), CCR (cinnamoyl-CoA reductase EC 1.2.1.44) and CAD (cinnamyl alcohol dehydrogenase EC 1.1.1.195) gene expression and PAL activity. At the same time, CCR activity only increased significantly in F. oxysporum-treated cells 24 h post elicitation. On the other hand, CAD activity measured for coniferyl alcohol formation was transiently decreased but a substrate-specific activation of CAD activity was observed in F. oxysporum-treated cells when using sinapyl alcohol as substrate. The accumulation of monolignol-derived products varied according to the elicitor used. B. cinerea or P. exigua-elicited cell cultures were characterised by a reinforcement of the cell wall by a deposit of 8-O-4'-linked non-condensed lignin structures and phenolic monomers, while at the same time no stimulation of 8-8'-linked lignan or 8-5'-linked phenylcoumaran lignan accumulation was observed. Additionally, elicitation of cell cultures with F. oxysporum extracts even triggered a strong incorporation of monolignols in the non condensed labile ether-linked lignin fraction concomitantly with a decrease in lignan and phenylcoumaran lignan accumulation. Several hypotheses are proposed to explain the putative role of these compounds in the defence response of flax cells against pathogens.

In vertebrates, the two-step peptide alpha-amidation reaction is catalyzed sequentially by two enzymatic activities contained within one bifunctional enzyme called PAM (peptidylglycine alpha-amidating mono-oxygenase). Drosophila head extracts contained both of these PAM-related enzyme activities: a mono-oxygenase (PHM) and a lyase (PAL). However, no bifunctional PAM protein was detected. We identified cDNAs encoding an active mono-oxygenase that is highly homologous to mammalian PHM. PHM-like immunoreactivity was found within diverse larval tissues, including the CNS, endocrine glands, and gut epithelium. Northern and Western blot analyses demonstrate RNA and protein species corresponding to the cloned PHM, but not to a bifunctional PAM, leading us to predict the existence of separate PHM and PAL genes in Drosophila. The Drosophila PHM gene displays an organization of exons that is highly similar to the PHM-encoding portion of the rat PAM gene. Genetic analysis was consistent with the prediction of separate PHM and PAL gene functions in Drosophila: a P element insertion line containing a transposon within the PHM transcription unit displayed strikingly lower PHM enzyme levels, whereas PAL levels were increased slightly. The lethal phenotype displayed by the dPHM P element insertion indicates a widespread essential function. Reversion analysis indicated that the lethality associated with the insertion chromosome likely is attributable to the P element insertion. These combined data indicate a fundamental evolutionary divergence in the genes coding for critical neurotransmitter biosynthetic enzymes: in Drosophila, the two enzyme activities of PAM are encoded by separate genes.

Tritium-containing affinity-labelling derivatives of phalloidin, an alkylating iodoacetyl compound (EAL) and a photolabile, carbene generating diazirine (PAL), have been reacted with rabbit muscle actin, the former after protection of thiol groups with N-ethylmaleimide. Labelled peptides generated by tryptic and/or thermolysin digestion were isolated by paper peptide mapping and characterized by determination of their amino acid sequences. EAL binds to methionine-119 and methionine-355; PAL binds to glutamic acid-117. These residues are located in regions with extremely conserved amino acid sequences. The cleft between the two domains of the actin monomer is suggested as the possible binding site for phalloidin.

The aim of this study was to compare the seven following commercially available activity monitors in terms of step count detection accuracy: Movemonitor (Mc Roberts), Up (Jawbone), One (Fitbit), ActivPAL (PAL Technologies Ltd.), Nike+ Fuelband (Nike Inc.), Tractivity (Kineteks Corp.) and Sensewear Armband Mini (Bodymedia). Sixteen healthy adults consented to take part in the study. The experimental protocol included walking along an indoor straight walkway, descending and ascending 24 steps, free outdoor walking and free indoor walking. These tasks were repeated at three self-selected walking speeds. Angular velocity signals collected at both shanks using two wireless inertial measurement units (OPAL, ADPM Inc) were used as a reference for the step count, computed using previously validated algorithms. Step detection accuracy was assessed using the mean absolute percentage error computed for each sensor. The Movemonitor and the ActivPAL were also tested within a nine-minute activity recognition protocol, during which the participants performed a set of complex tasks. Posture classifications were obtained from the two monitors and expressed as a percentage of the total task duration. The Movemonitor, One, ActivPAL, Nike+ Fuelband and Sensewear Armband Mini underestimated the number of steps in all the observed walking speeds, whereas the Tractivity significantly overestimated step count. The Movemonitor was the best performing sensor, with an error lower than 2% at all speeds and the smallest error obtained in the outdoor walking. The activity recognition protocol showed that the Movemonitor performed best in the walking recognition, but had difficulty in discriminating between standing and sitting. Results of this study can be used to inform choice of a monitor for specific applications.

The prevalence of obesity is increasing rapidly in all age groups in most EU-countries and is one of the fastest growing epidemics, now affecting 10-40% of the adult population. Obesity increases the risk of serious co-morbidities such as type 2 diabetes, cardiovascular disease, certain cancers and reduced life expectancy, and these complications may account for 5-10% of all health costs in EU countries. The risk of diabetes is particularly increased by obesity, and 80-95% of the increase in diabetes can be attributed to obesity and overweight with abdominal fat distribution. There is robust evidence from cross-sectional and longitudinal studies to support that an energy-dense, high fat diet and physical inactivity are independent risk factors for weight gain and obesity. Furthermore, interaction between dietary fat and physical fitness determine fat balance, so that the obesity promoting effect of a high fat diet is enhanced in susceptible subjects, particularly in sedentary individuals with a genetic predisposition to obesity. Ad libitum consumption of diets low in fat and high in protein and complex carbohydrates, with a low glycaemic index, contributes to the prevention of weight gain in normal weight subjects. It also causes a spontaneous weight loss of 3-4 kg in overweight subjects, and has beneficial effects on risk factors for diabetes and CVD. To prevent obesity and diabetes there are grounds for recommending the combination of increasing daily physical activity level to a PAL-value of at least 1.8 and reducing dietary fat content to 20-25 energy-% in sedentary subjects, and to 25-35% in more physically active individuals.

Thyroid hormones are major determinants of skeletal muscle differentiation in vivo. Triiodo-L-thyronine treatment promotes terminal muscle differentiation and results in increased MyoD gene transcription in myogenic cell lines; furthermore myoD and fast myosin heavy chain gene expression are activated in rodent slow twitch muscle fibers (Molecular Endocrinology 6: 1185-1194, 1992; Development 118: 1137-1147, 1993). We have identified a T3 response element (TRE) in the mouse MyoD promoter between nucleotide positions -337 and -309 (5' CTGAGGTCAGTACAGGCTGGAGGAGTAGA 3'). This sequence conferred an appropriate T3 response to an enhancerless SV40 promoter. In vitro binding studies showed that the thyroid hormone receptor alpha (TR alpha) formed a heterodimeric complex, with either the retinoid X receptor alpha or gamma 1 isoforms (RXR alpha, RXR gamm), on the MyoD TRE that was specifically competed by other well characterised TREs and not by other response elements. Analyses of this heterodimer with a battery of steroid hormone response elements indicated that the complex was efficiently competed by a direct repeat of the AGGTCA motif separated by 4 nucleotides as predicted by the 3-4-5 rule. EMSA experiments demonstrated that the nuclear factor(s) present in muscle cells that bound to the myoD TRE were constitutively expressed during myogenesis; this complex was competed by the myosin heavy chain, DR-4 and PAL-0 TREs in a sequence specific fashion. Western blot analysis indicated that TR alpha 1 was constitutively expressed during C2C12 differentiation. Mutagenesis of the myoD TRE indicated that the sequence of the direct repeats (AGGTCA) and the 4 nucleotide gap were necessary for efficient binding to the TR alpha/RXR alpha heterodimeric complex. In conclusion our data suggest that the TRE in the helix loop helix gene, myoD, is a target for the direct heterodimeric binding of TR alpha and RXR alpha/gamma. These results provide a molecular mechanism/model for the effects of triiodo-L-thyronine on in vitro myogenesis; the activation of myoD gene expression in the slow twitch fibres and the cascade of myogenic events regulated by thyroid hormone.

OBJECTIVE

To define the blood-brain barrier (BBB) characteristics of microvessels in the optic nerve head (ONH).

METHODS

Immunohistochemical staining of different regions of the ONH, retro-laminar optic nerve, and retina of human and monkey eyes was carried out, using antibodies against BBB markers (glucose transporter 1, transferrin receptor, and P-glycoprotein), the non-BBB marker PAL-E, and against plasma proteins fibrinogen and IgG, which serve as endogenous markers of nonspecific microvascular permeability. In the ONH of monkey eyes, the number of transport-related endothelial pinocytotic vesicles and their cellular distribution within the microvessels were determined by electron microscopy.

RESULTS

In both human and monkey eyes, only microvessels in the prelaminar region of the ONH were positive for the PAL-E antigen. The prelaminar region microvessels showed either no or weak expression of the transferrin receptor and P-glycoprotein but stained positive for glucose transporter 1. In human ONH, fibrinogen and IgG were present around microvessels in the prelaminar region but not in other parts of the optic nerve or retina. By electron microscopy, endothelial cells of prelaminar region microvessels contained a higher number of pinocytotic vesicles, located at the luminal and abluminal side of the endothelial cell membrane, in contrast to a mainly abluminal localization in microvessels of the retina and other parts of the optic nerve.

CONCLUSIONS

Microvessels in the prelaminar region of the ONH lack classical BBB characteristics and display nonspecific permeability, possibly mediated by vesicular transport.

Photorhabdus is a genus of Gram-negative bacteria from the family Enterobacteriaceae. Members of Photorhabdus have a complex life cycle during which the bacterium has a pathogenic interaction with insect larvae whilst also maintaining a mutualistic relationship with nematodes from the family Heterorhabditidae. During growth in the insect, Photorhabdus bacteria produce a broad-spectrum antibiotic identified as 3,5-dihydroxy-4-isopropylstilbene (ST). The biochemical pathway responsible for the production of this antibiotic has not been characterized. In this report, a mutant strain of Photorhabdus luminescens subsp. laumondii TT01, BMM901, has been isolated, by transposon mutagenesis, that is unable to produce the ST antibiotic. Using in silico studies, feeding experiments and biochemical analyses, it is shown that the gene mutated in this strain, stlA, encodes phenylalanine ammonia-lyase (PAL). PAL catalyses the non-oxidative deamination of l-phenylalanine to trans-cinnamic acid and the enzyme is ubiquitous in plants, where it is involved in the production of phenylpropanoids such as lignin and phytoalexins. However, this is the first report of PAL activity in a member of the Proteobacteria.

Although several wheat genes differentially expressed during the Russian wheat aphid resistance response have recently been identified, their requirement for and specific role in resistance remain unclear. Progress in wheat-aphid interaction research is hampered by inadequate collections of mutant germplasm and difficulty in transforming hexaploid wheat. Virus-induced gene silencing (VIGS) technology is emerging as a viable reverse genetics approach in cereal crops. However, the potential of VIGS for determining aphid defence gene function in wheat has not been evaluated. We report on the use of recombinant barley stripe mosaic virus (BSMV) to target and silence a WRKY53 transcription factor and an inducible phenylalanine ammonia-lyase (PAL) gene, both predicted to contribute to aphid defence in a genetically resistant wheat line. After inoculating resistant wheat with the VIGS constructs, transcript abundance was reduced to levels similar to that observed in susceptible wheat. Notably, the level of PAL expression was also suppressed by the WKRY53 construct, suggesting that these genes operate in the same defence response network. Both knockdowns exhibited a susceptible phenotype upon aphid infestation, and aphids feeding on silenced plants exhibited a significant increase in fitness compared to aphids feeding on control plants. Altered plant phenotype and changes in aphid behaviour after silencing imply that WKRY53 and PAL play key roles in generating a successful resistance response. This study is the first report on the successful use of VIGS to investigate genes involved in wheat-insect interactions.

For years, physical deconditioning has been thought to be both a cause and a result of back pain. As a consequence physical reconditioning has been proposed as treatment-goal in patients with chronic low back pain (LBP). However, it is still unclear whether a patient's physical fitness level really decreases after pain-onset. The objectives of the present study were, firstly, to test the assumption that long-term non-specific LBP leads to a decrease of the level of physical activity (disuse), secondly, to evaluate any development of physical deconditioning as a result of disuse in CLBP, and thirdly, to evaluate predictors for disuse in CLBP. A longitudinal cohort study over one year including 124 patients with sub-acute LBP (i.e., 4-7 weeks after pain onset) was performed. Main outcome measures were change in physical activity level (PAL) and physical fitness (measured by changes in body weight, body fat and muscle strength) over one year. Hypothesized predictors for disuse were: pain catastrophizing; fear of movement; depression; physical activity decline; the perceived level of disability and PAL prior to pain. Results showed that only in a subgroup of patients a PAL-decrease had occurred after the onset of pain, whereas no signs of physical deconditioning were found. Negative affect and the patients' perceived physical activity decline in the subacute phase predicted a decreased level of PAL over one year. Based on these results, we conclude that as to the assumption that patients with CLBP suffer from disuse and physical deconditioning empirical evidence is still lacking.

OBJECTIVE

Obesity is associated with lower rates of skeletal muscle fatty acid oxidation (FAO), which is linked to insulin resistance. FAO is reduced further in obese African-American (AAW) vs. white women (CW) and may also be lower in lean AAW vs. CW. In lean CW, endurance exercise training (EET) elevates the oxidative capacity of skeletal muscle. Therefore, we determined whether EET would elevate skeletal muscle FAO similarly in AAW and CW with a lower lipid oxidative capacity.

METHODS

In vitro rates of FAO were assessed in rectus abdominus muscle strips using [1- 14C] palmitate (Pal) from lean AAW [BMI = 24.2 +/- 0.9 (standard error) kg/m2] and CW (23.6 +/- 0.8 kg/m2) undergoing voluntary abdominal surgery. Lean AAW (22 +/- 0.9 kg/m(2)) and CW (24 +/- 0.8 kg/m2) and obese AAW (36 +/- 1.2 kg/m2) and CW (40 +/- 1.3 kg/m2) underwent 10 consecutive days of EET on a cycle ergometer (60 min/d, 75% peak oxygen uptake). FAO was measured in vastus lateralis homogenates as captured 14CO2 using [1- 14C] Pal, palmitoyl-CoA (Pal-CoA), and palmityl-carnitine (Pal-Car).

RESULTS

Muscle strip experiments showed suppressed rates of FAO (p = 0.03) in lean AAW vs. CW. EET increased the rates of skeletal muscle Pal oxidation (p = 0.05) in both lean AAW and CW. In obese subjects, Pre-EET Pal (but not Pal-CoA or Pal-Car) oxidation was lower (p = 0.05) in AAW vs. CW. EET increased Pal oxidation 100% in obese AAW (p < 0.05) and 59% (p < 0.05) in obese CW. Similar increases (p < 0.05) in post-EET FAO were observed for Pal-CoA and Pal-Car in both groups.

CONCLUSIONS

Both lean and obese AAW possess a lower capacity for skeletal muscle FAO, but EET increases FAO similarly in both AAW and CW. These data suggest the use of EET for treatment against obesity and diabetes for both AAW and CW.

All organisms respond to their environment to some extent, and for many microbes the variation in environment can be enormous. An important asset for coping with environmental variation is physiological versatility--a hallmark of many fungi. The ability of fungi to thrive over a wide range of pH is partly due to a genetic regulatory system that tailors gene expression to the ambient pH. Here we focus on the pH regulatory system of Aspergillus nidulans, where a novel signal transduction (pal) pathway mediates the first of two steps in the proteolytic processing of a transcription factor (PacC). Such processing is reminiscent of that of some well-known higher eukaryotic transcription factors, such as Cubitus interruptus, NF-kappa B and sterol regulatory element binding proteins. Intriguingly, endocytosis seems to be connected to pH signalling.

The Tol-Pal proteins of Escherichia coli are involved in maintaining outer membrane integrity. They form two complexes in the cell envelope. Transmembrane domains of TolQ, TolR, and TolA interact in the cytoplasmic membrane, while TolB and Pal form a complex near the outer membrane. The N-terminal transmembrane domain of TolA anchors the protein to the cytoplasmic membrane and interacts with TolQ and TolR. Extensive mutagenesis of the N-terminal part of TolA was carried out to characterize the residues involved in such processes. Mutations affecting the function of TolA resulted in a lack or an alteration in TolA-TolQ or TolR-TolA interactions but did not affect the formation of TolQ-TolR complexes. Our results confirmed the importance of residues serine 18 and histidine 22, which are part of an SHLS motif highly conserved in the TolA and the related TonB proteins from different organisms. Genetic suppression experiments were performed to restore the functional activity of some tolA mutants. The suppressor mutations all affected the first transmembrane helix of TolQ. These results confirmed the essential role of the transmembrane domain of TolA in triggering interactions with TolQ and TolR.

The effects of a male-specific meiotic mutant, paternal los (pal), in D. melanogaster have been examined genetically. The results indicate the following: (1) When homozygous in males, pal can cause loss, but not nondisjunction, of any chromosome pair. The pal-induced chromosome loss produces exceptional progeny that apparently failed to receive one, or more, paternal chromosomes and, in addition, mosaic progeny during whose early mitotic divisions one or more paternal chromosomes were lost. (2) Only paternally derived chromosomes are lost. (3) Mitotic chromosome loss can occur in homozygous pal+progeny of pal males. (4) Chromosomes differ in their susceptibility to pal-induced loss. The site responsible for the insensitivity vs. sensitivity of the X chromosome to pal mapped to the basal region of the X chromosome at, or near, the centromere. From these results, it is suggested that pal+acts in male gonia to specify a product that is a component of, or interacts with, the centromeric region of chromosomes and is necessary for the normal segregation of paternal chromosomes. In the presence of pal, defective chromosomes are produced and these chromosomes tend to get lost during the early cleavage divisions of the zygote. (5) The loss of heterologous chromosome pairs is not independent; there are more cases of simultaneous loss of two chromosomes than expected from independence. Moreover, an examination of cases of simultaneous somatic loss of two heterologs reveals an asymmetry in the early mitotic divisions of the zygote such that when two heterologs are lost at a somatic cleavage division, almost invariably one daughter nucleus fails to get either, and the other daughter nucleus receives its normal chromosome complement. It is suggested that this asymmetry is not a property of pal but is rather a normal process that is being revealed by the mutant. (6) The somatic loss of chromosomes in the progeny of pal males allows the construction of fate maps of the blastoderm. Similar fate maps are obtained using data from gynandromorphs and from marked Y chromosome (nonsexually dimorphic) mosaics.

Translational control is an essential mechanism of gene control utilized throughout development, yet the molecular mechanisms underlying translational activation and repression are poorly understood. We have investigated the translational control of the C. elegans caudal homolog, pal-1, and found that GLD-1, a member of the evolutionarily conserved STAR/Maxi-KH domain family, acts through a minimal pal-1 3' UTR element to repress pal-1 translation in the distal germline. We also provide data suggesting that GLD-1 may repress pal-1 translation after initiation. Finally, we show that GLD-1 represses the distal germline expression of the KH domain protein MEX-3, which was previously shown to repress PAL-1 expression in the proximal germline and which appears specialized to control PAL-1 expression patterns in the embryo. Hence, GLD-1 mediates a developmental switch in the control of PAL-1 repression, allowing MEX-3 to accumulate and take over the task of PAL-1 repression in the proximal germline, where GLD-1 protein levels decline.

A cDNA clone for phenylalanine ammonia-lyase (PAL) induced in wounded sweet potato (Ipomoea batatas Lam.) root was obtained by immunoscreening a cDNA library. The protein produced in Escherichia coli cells containing the plasmid pPALPAL as judged by Ouchterlony double diffusion assays. The M(r) of its subunit was 77,000. The cells converted [(14)C]-l-phenylalanine into [(14)C]-t-cinnamic acid and PAL activity was detected in the homogenate of the cells. The activity was dependent on the presence of the pPALPAL that is induced by wounding. Comparison of the deduced amino acid sequence with that of a PAL cDNA fragment from Phaseolus vulgaris revealed 78.9% homology. The sequence from amino acid residues 258 to 494 was highly conserved, showing 90.7% homology.

We have used conserved and nonconserved regions of cDNA clones for phenylalanine ammonia-lyase (PAL) and chalcone synthase (CHS) isolated from a soybean-nodule cDNA library to monitor the expression of members of the two gene families during the early stages of the soybean-Bradyrhizobium japonicum symbiosis. Our results demonstrate that subsets of the PAL and CHS gene families are specifically induced in soybean roots after infection with B. japonicum. Furthermore, by analyzing a supernodulating mutant line of soybean that differs from the wild-type parent in the number of successful infections, we show that the induction of PAL and CHS is related to postinfection events. Nodulated roots formed by a Nod+ Fix- strain of B. japonicum, resembling a pathogenic association, display induction of another distinct set of PAL and CHS genes. Our results suggest that the symbiosis-specific PAL and CHS genes in soybean are not induced by stress or pathogen interaction.

OBJECTIVE

Few studies have demonstrated improvement in adherence to Pediatric Advanced Life Support guidelines for severe sepsis and septic shock. We sought to improve adherence to national guidelines for children with septic shock in a pediatric emergency department with poor guideline adherence.

METHODS

Prospective cohort study of children presenting to a tertiary care pediatric emergency department with septic shock. Quality improvement (QI) interventions, including repeated plan-do-study-act cycles, were used to improve adherence to a 5-component sepsis bundle, including timely (1) recognition of septic shock, (2) vascular access, (3) administration of intravenous (IV) fluid, (4) antibiotics, and (5) vasoactive agents. The intervention focused on IV fluid delivery as a key driver impacting bundle adherence, and adherence was measured using statistical process control methodology.

RESULTS

Two-hundred forty-two patients were included: 126 subjects before the intervention (November 2009 to March 2011), and 116 patients during the QI intervention (October 2011 to May 2013). We achieved 100% adherence for all metrics, including (1) administration of 60 mL/kg IV fluid within 60 minutes (increased from baseline adherence rate of 37%), (2) administration of vasoactive agents within 60 minutes (baseline rate of 35%), and (3) 5-component bundle adherence (baseline rate of 19%). Improvement was sustained over 9 months. The number of septic shock cases between each death from this condition increased after implementation of the QI intervention.

CONCLUSIONS

Using QI methodology, we have demonstrated improved adherence to national guidelines for severe sepsis and septic shock.