Basic mechanisms of transcription initiation are conserved from yeast to man. However, in contrast to genes transcribed by RNA polymerases II and III, ribosomal gene transcription by RNA polymerase I (Pol I) is species-specific. Promoter selectivity is mediated by SL1/TIF-IB, a multiprotein complex containing the TATA-binding protein (TBP) and TBP-associated factors (TAFs) which bind to DNA and nucleate the assembly of initiation complexes. Using a human cell line that expresses epitope-tagged yeast TBP, we have isolated a chimeric complex consisting of yeast TBP and human TAFs which faithfully promotes human rDNA transcription in vitro. This result argues that specific interactions between TBP and Pol I-specific TAFs have been evolutionarily conserved between distant species. In addition, this finding also underscores the importance of TAFs in determining promoter selectivity of Pol I.

RNA interference (RNAi) is a useful reverse genetics tool for investigation of gene function as well as for practical applications in many fields including medicine and agriculture. RNAi works very well in coleopteran insects including the Colorado potato beetle (CPB), Leptinotarsa decemlineata. We used a cell line (Lepd-SL1) developed from CPB to identify genes that play key roles in RNAi. We screened 50 genes with potential functions in RNAi by exposing Lepd-SL1 cells to dsRNA targeting one of the potential RNAi pathway genes followed by incubation with dsRNA targeting inhibitor of apoptosis (IAP, silencing of this gene induces apoptosis). Out of 50 genes tested, silencing of 29 genes showed an effect on RNAi. Silencing of five genes (Argonaute-1, Argonaute-2a, Argonaute-2b, Aubergine and V-ATPase 16 kDa subunit 1, Vha16) blocked RNAi suggesting that these genes are essential for functioning of RNAi in Lepd-SL1 cells. Interestingly, Argonaute-1 and Aubergine which are known to function in miRNA and piRNA pathways respectively are also critical to siRNA pathway. Using 32P labeled dsRNA, we showed that these miRNA and piRNA Argonautes but not Argonaute-2 are required for processing of dsRNA to siRNA. Transfection of pIZT/V5 constructs containing these five genes into Sf9 cells (the cells where RNAi does not work well) showed that expression of all genes tested, except the Argonaute-2a, improved RNAi in these cells. Results from Vha16 gene silencing and bafilomycin-A1 treatment suggest that endosomal escape plays an important role in dsRNA-mediated RNAi in Lepd-SL1 cells.

BACKGROUND

Previous studies support the fact that extracorporeal shockwave (SW) induces angiogenesis and improves symptoms in patients affected by limb ischemia. The aim of this study was to evaluate the effects of SW therapy in patients with peripheral artery disease (PAD).

METHODS

Twenty-two patients were enrolled in this study and were randomly assigned into two groups: SW treatment (12 patients, 67 ± 9 years) and control (10 patients, 68 ± 12 years). The inclusion criteria were the following: age over 40 years, PAD diagnosis, optimal medical therapy, and ankle-brachial index less than 0.9. SW therapy was administered using the Minilith® SL1 litotriptor with an ultrasound guide able to detect the target area using a B-mode technique and a 7.5 MHz convex probe emitting 2,000 impulses with an energy flux density of 0.03 mJ/mm(2).

RESULTS

The variation in the degree of stenosis before and after treatment was statistically significant between the groups (-9% ± -10% vs. 0% ± 0%; P = 0.001). In addition, a significantly higher number of treated patients than controls showed a reduction in the Fontaine stage (12 [63%] vs. 0 [0%]; P < 0.001). This result was confirmed by analyzing the difference in patients' pain-free walking distance before and after SW therapy (76 ± 46 m vs. 0 ± 0 m for treated patients vs. controls; P < 0.001) and the difference in pain severity (measured on a pain scale; -1.4 ± 0.5 in the treated patients vs. -0.2 ± 0.4 in the controls; P < 0.001).

CONCLUSIONS

On the basis of these results the authors hypothesized a direct effect of SW on the ultrastructural composition of the vessel walls, inducing a reduction in artery stenosis. These data support the application of SW therapy as a new medical tool to improve the natural clinical course of PAD.

The deoxyoligoribonucleotide d(CTTGCTGAAGCGCGCACGGCAAG) (dSL1) corresponding to the reverse transcripted sequence of the dimerization initiation site SL1 of HIV- 1(Lai) RNA was synthesized using phosphoramidite chemistry. Like its oligoribonucleotide counterpart, dSL1 dimerized spontaneously in solution. Here we report the first NMR solution structure of a kissing complex formed with two DNA strands. The melting point of the DNA dimer (35 degrees C) was found slightly higher than the one of the corresponding RNA dimer (32 degrees C). Despite this only slight difference in melting point, several structural differences were observed between the ribo- and the deoxyribo- dimers. The solution structure of the deoxy- dimer was a symmetric homodimer with a loop-loop interaction stabilized by four central G-C base-pairs, a head to tail A-A base-pair arrangement between the A8 residues of the two strands and a stacking of A9 with C15. As a consequence, G10 was not paired and occupied a position outside the stem and the loop. Each stem was formed by seven base-pairs whose axis made an angle of about 100 degree with the plane of the loops. The distortion of the helix at the junction of the stem and of the loop induced a fold up of the A8pA9 step with a phosphate-phosphate distance lowered to 4.5 A. The plane of the non-canonical A-A base-pair was oriented perpendicularly to the axis of the stems. The four central base-pairs formed an open fan-shaped motif with an angle of 20 degrees between the bases and each of them was oriented perpendicularly to the A8-A8 plane. The deviation of the computed chemical shifts and the experimental ones for the aromatic proton was always less than 0.25ppm for each of the 16 converged solution structures and their average less than 0.1ppm.

OBJECTIVE

Extracorporal shock wave therapy (FSWT) is applied in the case of supraspinatus tendinitis if conservative therapies have failed. So far there has been no controlled study comparing the effectiveness of ESWT with an established conservative method of therapy such as X-ray stimulation radiotherapy.

METHODS

Thirty patients with chronic supraspinatus tendinitis were admitted into the prospective randomised study. After randomisation, the patients were treated either three times with 2000 pulses (energy flux density ED+ 0.33 mJ/mm2) with a Storz Minilith SL1 after one week, or with X-ray stimulation radiotherapy with 6 x 0.5 Gy on the ICRU reference point (1 neutral fraction/day) with cobalt 60 gamma rays. Primary endpoint was the age-corrected constant score.

RESULTS

In the ESWT group the average age-corrected constant score rose from 50.1 points before ESWT to 91.5 points after 12 weeks and to 97.8 after 52 weeks. In the radiotherapy group it improved from 47.6 through 79.5 points to 87.4 points.

CONCLUSIONS

No statistically significant differences were proven between ESWT and radiotherapy. ESWT appears to be at least equivalent to radiotherapy in treating chronic supraspinatus tendinitis syndrome and can avoid a dose of radiation for patients and staff. A comprehensive randomised study is, however necessary to ensure the equivalence of ESWT.

Operons are a common mode of gene organization in Caenorhabditis elegans. Similar gene arrangements suggest that functional operons may exist in Brugia malayi. To definitively test this hypothesis, a bicistronic reporter vector consisting of an upstream firefly luciferase gene and a downstream renilla luciferase gene was constructed. The genome was then surveyed to identify 15 gene pairs that were likely to represent operons. Two of four domains upstream of the 5' gene from these clusters exhibited promoter activity. When constructs replicating the promoter and intergenic arrangement found in the native putative operon were transfected into embryos, both firefly and renilla activities were detected, while constructs with the promoter alone or intergenic region alone produced no activity from the downstream reporter. These data confirm that functional operons exist in B. malayi. Mutation of three U-rich element homologues present in one of the operons resulted in a decrease in downstream renilla reporter activity, suggesting that these were important in mRNA maturation. Hemi-nested reverse transcriptase-PCR assays demonstrated that while the mRNA encoding the native downstream open reading frame of one operon contained an SL1 spliced leader at its 5' end, the renilla gene mRNA produced from the corresponding transgenic construct did not.

Mammalian ribosomal RNA genes (rDNA) are transcribed by RNA polymerase I and at least two auxiliary factors, UBF and SL1/TFID/TIF-IB. It has also been reported that an additional factor(s) is required to reconstitute efficient initiation of rDNA transcription in vitro, depending upon the procedures of chromatographic separation. In an attempt to elucidate the molecular identity of such yet uncertain activities, we have developed agarose gel shift and UV cross-linking assays to detect proteins directly bound to the core promoter region of murine rDNA. With these techniques, we identified a 70 kDa protein (p70) in the flow-through fraction of a phosphocellulose column (TFIA-fraction). Interestingly, the binding of p70 to the rDNA core promoter was observed only in the presence of the SL1-containing fraction. The probable human orthologue of p70 was also detected in HeLa cells. Consistent with the observation that p70 bound to the core promoter only in the presence of the TFIA- and SL1-fractions, alteration of DNase I footprint pattern over the core promoter element was demonstrated by cooperative action of the TFIA- and SL1-fractions. A reconstituted in vitro transcription assay with further purified p70 indicated that p70 was required for accurate initiation of rDNA transcription. These results indicate that the p70 identified recently by the current DNA-binding experiments represents a novel transcription factor in rDNA transcription.

The full-length cDNA and the corresponding gene of the heat shock protein 90, Mt-Hsp90, were isolated and characterized in the plant parasitic nematode Meloidogyne artiellia. The full-length Mt-Hsp90 cDNA contained a 5' untranslated region (UTR) of 45 bp with the 22 bp trans-spliced leader SL1, an ORF of 2172 bp encoding a polypeptide of 723 amino acids and a 3' UTR of 191 bp. The deduced amino acid sequence of Mt-hsp90 showed high similarity with other known Hsp90s. Five conserved amino acid signatures indicated that Mt-hsp90 is a cytosolic member of the Hsp90 family. The gene consists of 10 exons and 9 introns, a more expanded gene structure compared to the corresponding Caenorhabditis elegans gene, daf-21. Mt-hsp90 gene was constitutively expressed at high levels in all developmental stages of M. artiellia. Egg masses and second stage juveniles (J2s) were exposed at 5 degrees and 30 degrees C for different periods of times in order to explore the impact of adverse temperature on Mt-hsp90 gene expression. Expression levels of Mt-hsp90 were examined by fluorescent real-time PCR. At 30 degrees C a burst of expression for Mt-hsp90 was observed in J2s after 2 h of heat shock treatment, then expression dropped with longer exposing times, although remaining still relatively high after 24 h. This temperature did not affect Mt-hsp90 gene expression in the egg masses. However, egg masses exposed at 5 degrees C showed a little but gradual increase in the mRNA level with time. By contrast, no significant changes in the Mt-hsp90 level were observed in J2s exposed to cold. These data show that egg masses and J2s exposed to cold and heat stresses have different expression profiles suggesting that Mt-Hsp90 may provide a link between environmental conditions and the life cycle of the nematode.

Encapsidation of human immunodeficiency virus type 1 (HIV-1) RNA involves specific interactions between viral Gag proteins and viral RNA elements located at the 5' untranslated region (UTR). These RNA elements are termed packaging (psi) or encapsidation (E) signals and mainly comprise the stem-loop 1 (SL1) and SL3 RNA structures. We have previously shown that deletion of the SL1 sequences is compensated by second-site mutations within Gag. Similar studies are now extended to SL3 and the results demonstrate that deletion of this RNA structure is rescued by two point mutations, i.e., A11V in p2 and I12V in nucleocapsid (NC). These two compensatory mutations are different from those associated with the rescue of SL1 deletion, suggesting that SL1 and SL3 may bind to different residues of Gag during viral RNA packaging. Analysis of virion-derived RNA in native agarose gels shows that deletion of SL3 leads to decreases in both viral RNA packaging and dimerization. These defects are corrected by the compensatory mutations A11V and I12V. Yet, defects in viral RNA dimerization at an early stage that were caused by the SL3 deletion in the context of a viral protease-negative mutation cannot be overcome by these two suppressor mutations. Therefore, the positive effects of A11V and I12V on dimerization of the SL3-deleted RNA must have taken place at the maturation stage.

The genome of all retroviruses consists of two identical copies of an RNA sequence associated in a non-covalent dimer. A region upstream from the splice donor (SL1) comprising a self-complementary sequence is responsible for the initiation of the dimerization. This region is able to dimerize in two conformations: a loop-loop complex or an extended duplex. Here, we solve by 2D NMR techniques the solution structure of a 23-nucleotide sequence corresponding to HIV-1 SL1(Lai) in which the mutation G12->>A12 is included to prevent dimerization. It is shown that this monomer adopts a stem-loop conformation with a seven base pairs stem and a nine nucleotide loop containing the G10 C11 A12 C13 G14 C15 sequence. The stem is well structured in an A-form duplex, while the loop is more flexible even though elements of structure are evident. We show that the structure adopted by the stem can be appreciably different from its relaxed structure when the adenines A8, A9 and A16 in the loop are mechanically constrained. This point could be important for the efficiency of the dimerization. This experimental study is complemented with a 10 ns molecular dynamics simulation in the presence of counterions and explicit water molecules. This simulation brings about information on the flexibility of the loop, such as a hinge motion between the stem and the loop and a labile lattice of hydrogen bonds in the loop. The bases of the nucleotides G10 to C15 were found outside of the loop during a part of the trajectory, which is certainly necessary to initiate the dimerization process of the genuine SL1(Lai) sequence.

Analogues of alamethicin, a 20-mer amphipathic helical peptide with ionophore activity, in the sequence of which all Aib residues were substituted by Ala (A1) or Leu (L1), were synthesized by the solid phase method, purified by high performance liquid chromatography and characterized by fast atomic bombardment mass spectrometry. Infrared and CD studies showed that A1 easily underwent a transconformation to beta-structure whereas L1 displayed a predominant alpha-helical character, thus being a potential ionophore model. Its voltage-dependent multistate activity in model membranes showed that Aib is not a requisite residue to observe an alamethicin-like behavior. However, as the lifetime of the single channels was much shorter than for alamethicin, the peptide chain was lengthened by a Leu (LL1) or a Ser (SL1) residue. The last peptide gave an increased channel lifetime, but the design of other non-Aib peptides, taking into account the hydroxyl C-terminus and side-chain interactions between helices in a barrel-stave bundle, is desirable to approach more closely the alamethicin activity.

5'-end cDNA fragments of the Caenorhabditis elegans DNA topoisomerase I gene were obtained by rapid amplification of the cDNA ends from C. elegans mRNAs. The presence of a SL1 sequence at the 5'-terminus of the cDNA sequence suggested trans-splicing of the pre-mRNA. By comparing the complete cDNA sequence with the genomic lambda DNA clones, the gene structure composed of five exons was established. Alternative splicing deleting the second exon was observed in the cDNA fragments obtained by a gene-specific reverse transcription followed by polymerase chain reactions. The shorter mRNA missing the second exon was expressed at all the developmental stages, while the full-length mRNA was present only in embryos.

Four bacterial strains isolated from hydrocarbon-contaminated soils in Lagos, Nigeria, displayed extensive degradation abilities on carbazole, an N-heterocyclic aromatic hydrocarbon. Physicochemical analyses of the sampling sites (ACPP, MWO, NESU) indicate gross pollution of the soils with a high hydrocarbon content (157,067.9 mg/kg) and presence of heavy metals. Phylogenetic analysis of the four strains indicated that they were identified as Achromobacter sp. strain SL1, Pseudomonas sp. strain SL4, Microbacterium esteraromaticum strain SL6, and Stenotrophomonas maltophilia strain BA. The rates of degradation of carbazole by the four isolates during 30 days of incubation were 0.057, 0.062, 0.036, and 0.050 mg L(-1) h(-1) for strains SL1, SL4, SL6, and BA. Gas chromatographic (GC) analyses of residual carbazole after 30 days of incubation revealed that 81.3, 85, 64.4, and 76 % of 50 mg l(-1) carbazole were degraded by strains SL1, SL4, SL6, and BA, respectively. GC-mass spectrometry and high-performance liquid chromatographic analyses of the extracts from the growing and resting cells of strains SL1, SL4, and SL6 cultured on carbazole showed detection of anthranilic acid and catechol while these metabolites were not detected in strain BA under the same conditions. This study has established for the first time carbazole angular dioxygenation and mineralization by isolates from African environment.

Fragile X syndrome (FXS), the most common form of inherited intellectual disability, is caused by the silencing of the FMR1 gene encoding an RNA-binding protein (FMRP) mainly involved in translational control. We characterized the interaction between FMRP and the mRNA of GRK4, a member of the guanine nucleotide-binding protein (G protein)-coupled receptor kinase super-family, both in vitro and in vivo. While the mRNA level of GRK4 is unchanged in the absence or in the presence of FMRP in different regions of the brain, GRK4 protein level is increased in Fmr1-null cerebellum, suggesting that FMRP negatively modulates the expression of GRK4 at the translational level in this brain region. The C-terminal region of FMRP interacts with a domain of GRK4 mRNA, that we called G4RIF, that is folded in four stem loops. The SL1 stem loop of G4RIF is protected by FMRP and is part of the S1/S2 sub-domain that directs translation repression of a reporter mRNA by FMRP. These data confirm the role of the G4RIF/FMRP complex in translational regulation. Considering the role of GRK4 in GABAB receptors desensitization, our results suggest that an increased GRK4 levels in FXS might contribute to cerebellum-dependent phenotypes through a deregulated desensitization of GABAB receptors.

We have amplified by PCR the sequences of the 5 S ribosomal spacer of Setaria labiatopapillosa and Foleyella furcata. After sequencing, these sequences have been compared with those of Dirofilaria immitis and Dirofilaria repens. Two major goals have been achieved: (i) the establishment of a multiplex PCR-based diagnostic assay, applicable to identify the four species in vertebrate and invertebrate hosts; (ii) the identification, in S. labiatopapillosa and F. furcata, of a canonical spliced leader 1 (SL1) sequence, so confirming that only D. repens, of the filarial parasites so far studied, shows a peculiar SL1 sequence. The PCR assay here developed and the analysis of the 5 S ribosomal spacer, can further improve both epidemiological and molecular analysis of these filarial species.

A previous study showed that prebiotics and synbiotics administered in ovo into the egg air cell on the 12th day of incubation enhance the growth and development of chickens. However, the influence of this procedure on the development and efficiency of the innate immune system of broiler chickens is unclear. Therefore, the aim of this study was to evaluate whether the early (on the 12th day of embryo development) in ovo administration of selected prebiotics (inulin - Pre1 and Bi²tos - Pre2) and synbiotics (inulin + Lactococcus lactis subsp. lactis IBB SL1 - Syn1 and Bi²tos + L. lactis subsp. cremoris IBB SC1 - Syn2) influences the innate immune system.

Chickens (broiler, Ross 308) that were treated with Pre1 exhibited a decreased H/L ratio on D7, but an increased H/L ratio was observed on D21 and D35. In the remaining experimental groups, an increase in the H/L ratio was observed on D21 and D35. The oxidative potential of leukocytes measured using the NBT test increased on D21 in Pre2 and Syn1 groups. The rate of the phagocytic ability of leukocytes increased in Pre1 and Syn1 groups on D21. The phagocytic index decreased in Pre1 and Syn2 groups on D21 and D35. Concurrently, the count of WBC in circulating blood decreased on D21 in Pre1, Pre2, and Syn1 groups. The hematocrit value was increased in Syn1 chickens on D21, in Pre1 chickens on D35, and in Syn2 chickens on both time points.Early in ovo treatment of chicken embryos with prebiotics and synbiotics may temporarily modulate not only the production/maturation of leukocytes but also their reactivity.

Spliced-leader (SL) trans-splicing has been found in all molecularly characterized nematode species to date, and it is likely to be a nematode synapomorphy. Most information regarding SL trans-splicing has come from the study of nematodes from a single monophyletic group, the Rhabditida, all of which employ SL RNAs that are identical to, or variants of, the SL1 RNA first characterized in Caenorhabditis elegans. In contrast, the more distantly related Trichinella spiralis, belonging to the subclass Dorylaimia, utilizes a distinct set of SL RNAs that display considerable sequence diversity. To investigate whether this is true of other members of the Dorylaimia, we have characterized SL RNAs from Prionchulus punctatus. Surprisingly, this revealed the presence of a set of SLs that show clear sequence similarity to the SL2 family of spliced leaders, which have previously only been found within the rhabditine group (which includes C. elegans). Expression of one of the P. punctatus SL RNAs in C. elegans reveals that it can compete specifically with the endogenous C. elegans SL2 spliced leaders, being spliced to the pre-mRNAs derived from downstream genes in operons, but does not compete with the SL1 spliced leaders. This discovery raises the possibility that SL2-like spliced leaders were present in the last common ancestor of the nematode phylum.

RNA interference (RNAi) is being used to develop methods to control pests and disease vectors. RNAi is robust and systemic in coleopteran insects but is quite variable in other insects. The determinants of efficient RNAi in coleopterans, as well as its potential mechanisms of resistance, are not known. RNAi screen identified a double-stranded RNA binding protein (StaufenC) as a major player in RNAi. StaufenC homologs have been identified in only coleopteran insects. Experiments in two coleopteran insects, Leptinotarsa decemlineata and Tribolium castaneum, showed the requirement of StaufenC for RNAi, especially for processing of double-stranded RNA (dsRNA) to small interfering RNA. RNAi-resistant cells were selected by exposing L. decemlineata, Lepd-SL1 cells to the inhibitor of apoptosis 1 dsRNA for multiple generations. The resistant cells showed lower levels of StaufenC expression compared with its expression in susceptible cells. These studies showed that coleopteran-specific StaufenC is required for RNAi and is a potential target for RNAi resistance. The data included in this article will help improve RNAi in noncoleopteran insects and manage RNAi resistance in coleopteran insects.

The effect of the in ovo application of selected prebiotics and synbiotics on the humoral immune response against T-dependent (SRBC) and T-independent (dextran) antigens and delayed-type hypersensitivity (DTH) to phytohemagglutinin was studied. On the 12th day of incubation, 800 eggs (Ross 308) were divided into five groups and injected into the egg air chamber with prebiotic inulin (Pre1), Bi²tos (Pre2), a synbiotic composed of inulin and Lactococcus lactis subsp. lactis IBB SL1 (Syn1), a synbiotic composed of Bi²tos and L. lactis subsp. cremoris IBB SC1 (Syn2), and physiological saline (control group; C). The chickens were immunized twice at the 7th and 21st day of life with SRBC and dextran. A DTH test was performed on the 7th, 21st, and 35th day. The application of prebiotics and synbiotics had no significant effect on the humoral immune response. SRBC-immunized in ovo Pre1- and Pre2-treated chickens showed significantly higher serum IgG levels than the control. A significant effect on the DTH reaction was detected on the 7th (Pre1 < C) and 21st (Pre2 > Syn2) day. However; Bi²tos may transiently stimulate the cellular immune response on the 21st day. It may be concluded that the application of inulin in an egg air chamber on the 12th day of incubation may stimulate the secondary immune response. The inulin-treated group exhibited a lower mortality rate than the control group.

SHAPE technology was used to analyze RNA secondary structure of the 5' most 474 nts of the MHV-A59 genome encompassing the minimal 5' cis-acting region required for defective interfering RNA replication. The structures generated were in agreement with previous characterizations of SL1 through SL4 and two recently predicted secondary structure elements, S5 and SL5A. SHAPE provided biochemical support for four additional stem-loops not previously functionally investigated in MHV. Secondary structure predictions for 5' regions of MHV-A59, BCoV and SARS-CoV were similar despite high sequence divergence. The pattern of SHAPE reactivity of in virio genomic RNA, ex virio genomic RNA, and in vitro synthesized RNA was similar, suggesting that binding of N protein or other proteins to virion RNA fails to protect the RNA from reaction with lipid permeable SHAPE reagent. Reverse genetic experiments suggested that SL5C and SL6 within the nsp1 coding sequence are not required for viral replication.

Dramatic changes in the patterns of transcription are a common feature of early development. We have used F9 embryonal carcinoma cells as a model system to study gene regulation during an early stage of murine embryogenesis. We find that transcription by RNA polymerase I decreases when F9 cells differentiate into parietal endoderm. The reduced rate of transcription is associated with a down-regulation of several components of the class I transcription apparatus. The most substantial change involves the essential factor SL1, which is a multisubunit complex that contains the TATA-binding protein and three TATA-binding protein-associated factors (TAFs). The abundance of two of these TAFs, TAFI48 and TAFI95, decreases during F9 cell differentiation. Developmental regulation of a specific class of genes may therefore be achieved through changes in the availability of TAFs.

The aim of this study was to assess stroke rate variability in elite female swimmers (200-m events, all four techniques) by comparing the semi-finalists at the Athens 2004 Olympic Games (n = 64) and semi-finalists at the French National 2004 Championship (n = 64). Since swimming speed (V) is the product of stroke rate (SR) and stroke length (SL), these three variables and the coefficient of variation of stroke rate (CV(SR)) of the first and second 100 m were determined (V1, V2; SR1, SR2; SL1, SL2; CV(SR)1, CV(SR)2) and differences between the two parts of the events were calculated (DeltaV; DeltaSR; DeltaSL; DeltaCV(SR)). When the results for the four 200-m events were analysed together, SR1, SR2, SL1, and SL2 were higher (alpha = 0.05, P< 0.001) and DeltaV, DeltaSR, and DeltaCV(SR) were lower (P< 0.01) in the Olympic group than in the National group. The Olympic-standard swimmers exhibited faster backstrokes and longer freestyle strokes (P < 0.05). Both CV(SR)1 and CV(SR)2 were lower for freestyle and backstroke races in the Olympic group than in the National group (P < 0.001). Our results suggest that stroke rate variability is dependent on an interaction between the biomechanical requisites of the task (techniques) and the standard of the swimmer.

Piwi proteins are important for germ cell development in most animals. These proteins are guided to specific targets by small guide RNAs, referred to as piRNAs or 21U RNAs in Caenorhabditis elegans In this organism, even though genetic screens have uncovered 21U RNA biogenesis factors, little is known about how these factors interact or what they do. Based on the previously identified 21U biogenesis factor PID-1 (piRNA-induced silencing-defective 1), we here define a novel protein complex, PETISCO (PID-3, ERH-2, TOFU-6, and IFE-3 small RNA complex), that is required for 21U RNA biogenesis. PETISCO contains both potential 5' cap and 5' phosphate RNA-binding domains and interacts with capped 21U precursor RNA. We resolved the architecture of PETISCO and revealed a second function for PETISCO in embryonic development. This essential function of PETISCO is mediated not by PID-1 but by the novel protein TOST-1 (twenty-one U pathway antagonist). In contrast, TOST-1 is not essential for 21U RNA biogenesis. Both PID-1 and TOST-1 interact directly with ERH-2 using a conserved sequence motif. Finally, our data suggest a role for TOST-1:PETISCO in SL1 homeostasis in the early embryo. Our work describes a key complex for 21U RNA processing in C. elegans and strengthens the view that 21U RNA biogenesis is built on an snRNA-related pathway.

It is believed that the genomic 5' untranslated region (UTR) of Arterivirus plays crucial roles in viral genomic replication, subgenomic mRNA transcription and protein translation, yet the structure and function still remain largely unknown. In this study, we conducted serial nucleotide truncation, ranging from 1 to 190 nucleotides, to the 5' UTR of the porcine reproductive and respiratory syndrome virus (PRRSV) infectious full-length cDNA clone pAPRRS. In vitro synthetic RNAs were transfected into MARC-145 cells for further genetic and virologic analysis. Our results demonstrated that the first three nucleotides of PRRSV 5' UTR were dispensable for virus viability, which however was repaired with foreign sequences. In order to assess if the primary sequence or structural element play more important regulatory roles, the CMV promoter-driven 5' UTR truncation mutant cDNA clones were directly transfected into the BHK-21 cell lines. We found that PRRSV tolerated the first 16 nucleotides sequence alteration of 5' UTR without losing virus viability. However, these revertant viruses contained a range of non-templated with unknown origin exogenous nucleotides in the repaired 5' end. Further analyses revealed that the 5' proximal stem-loop 1 (SL1) in the highly structured 5' UTR was invariably required for virus infectivity. Taken together, we conclude that authentic 5'-proximal primary sequence is nonessential, but the resultant structural elements are probably indispensable for PRRSV infectivity.