J Immunol 199(3): 866-873

PMC: PMC5538185

PMID: 28637902

TGFβ1 Suppresses IL-33-induced Mast Cell Function

Anuya Paranjape+6 authors

Introduction

The prevalence of allergic diseases caused by environmental and genetic factors has increased considerably over the past two decades. While the biology of these diseases is complex, all share a central role for mast cell activation as an initiator of symptoms. IgE-mediated mast cell activation elicits release of preformed mediators such as histamine and the production of arachidonic acid metabolites, cytokines, and chemokines that collectively increase vascular permeability, constrict airways, and recruit leukocytes to inflammatory sites (1–3). However, IgE-mediated responses are not exclusively responsible for allergic inflammation. Recently there has been a growing appreciation for the role of other mast cell activators, including the inflammatory cytokine IL-33 (4, 5).

IL-33 is a member of the IL-1 family and often termed an alarmin because it is released upon tissue damage. IL-33 activates cells via a complex of the T1/ST2 (IL-1RL1) and the IL-1 receptor accessory protein (IL-1RAcP). This elicits a MyD88/IRAK-mediated signaling cascade culminating in NFκB- and AP-1-dependent transcription of inflammatory cytokines and chemokines promoting the Th2 response (6–8). Cells located at the host/environment interface are best known for producing IL-33, including endothelial cells, epithelial cells, fibroblasts, and keratinocytes (9). More recently, immune cells such as dendritic cells, monocytes/macrophages, and mast cells have also been found to express IL-33 (10). As our understanding of IL-33 has grown, so has the list of IL-33-responsive cells, which now includes Th2 cells, mast cells, group 2 innate lymphoid cells (ILC2), macrophages, basophils, eosinophils, and NK cells (reviewed in (9)).

Because mast cells and Th2 cells were among the first noted IL-33 responders, there has been considerable progress in understanding how IL-33 contributes to allergic disease. Important studies include the demonstration that IL-33 is elevated in asthmatic patients and mouse asthma models, and that blocking IL-33 or T1/ST2 reduces asthma-like symptoms in relevant mouse models (11–15). While it is a poor inducer of degranulation, IL-33 augments mast cell degranulation triggered by the IgE receptor (16, 17). This, coupled with its strong induction of inflammatory cytokines prompted us to question how IL-33-mediated mast cell activation is controlled.

Mast cell activation is regulated by feedback signals, including cytokines such as TGFβ1. For example, we and others have found that TGFβ1 suppresses mast cell responses to IgE (18–21). TGFβ1 has been implicated in the development of autoimmune disorders, chronic inflammatory conditions and allergic diseases such as asthma and atopic dermatitis (22, 23) (24). The TGFβ superfamily is comprised of more than 30 members, including activins, inhibins, bone morphogenic proteins (BMP) and anti-müllerian hormones (AMH) that play a critical role in regulating tissue repair, embryogenesis, cartilage homeostasis, cell growth, proliferation and cancer (25). Furthermore, TGFβ1 is critical for Treg, Th9 and Th17 differentiation (26, 27). Thus, clinical therapies based on modulation of this cytokine represent an important new approach to the treatment of immune disorders.

TGFβ1 is present at high (ng/ml or ng/mg) concentrations as an inactive precursor bound to latency-associated protein in the blood and connective tissue (28). Mast cell proteases, released after activation, can cleave and activate latent TGFβ proteins (29, 30), promoting feedback signaling. In the current study, we demonstrate that TGFβ1 inhibits IL-33-mediated mast cell activation in vitro and in vivo. TGFβ1 suppressed IL-33-mediated cytokine secretion, reduced T1/ST2 expression, inhibited IL-33-mediated Akt and ERK phosphorylation, and decreased NFκB and AP-1 activity. Importantly, TGFβ1 injection blunted the increase in systemic cytokines elicited by IL-33 challenge in vivo. These results were consistent in the human system, where skin-derived mast cells were similarly inhibited by TGFβ1. These findings demonstrate that TGFβ1 is a potent suppressor of the IL-33-mediated mast cell response, further supporting the role of TGFβ1 in mast cell homeostasis and allergic disease.

Materials and Methods

Animals

C57BL/6J, BALB/cJ, C3HeJ and 129S1/SvImJ (hence referred to as 129/Sv) mice were purchased from the Jackson Laboratory (Bar Harbor, ME) and maintained in a pathogen-free facility at Virginia Commonwealth University (VCU). Protocols and studies involving animals were performed in accordance with VCU Institutional Animal Care and Use Committee guidelines.

Mouse mast cell cultures

Bone marrow-derived mast cell cultures (BMMC) were derived from mouse femurs by culture in complete RPMI (cRPMI) 1640 medium (Invitrogen Life Technologies, Carlsbad, CA) containing 10% FBS, 2 mM L-glutamine, 100 U/ml penicillin, 100 μg/ml streptomycin, 1 mM sodium pyruvate, and 10 mM HEPES (Biofluids, Rockville, MD), supplemented with IL-3-containing supernatant from WEHI-3 cells and SCF-containing supernatant from BHK-MKL cells for 21–28 days. The final concentration of IL-3 and SCF was adjusted to 1.5 and 15 ng/ml, respectively, as measured by ELISA. For in vitro analyses, BMMC were washed and incubated at 37°C for 4 hours in cRPMI 1640 without cytokines for cell cycle synchronization. Cells were then plated at 5×10^{cells/ml and incubated at 37°C for the indicated times in cRPMI 1640 with recombinant mouse IL-3 + SCF (10 ng/ml each) with or without TGFβ1 (10 ng/ml unless otherwise noted). At the end of this period, equal numbers of live cells were re-plated at 1×10}^{cells/ml in the same conditions and activated with 50 ng/ml IL-33 for 16–24 hours, after which culture supernatants were harvested for ELISA analysis. For IgE-mediated activation, Purified DNP-specific mouse IgE was purchased from BD Pharmingen (San Diego, CA).}

Cytokines and reagents

Dinitophenyl-coupled human serum albumin (DNP-HSA) was purchased from Sigma Fine Chemicals (St. Louis, MO). IL-3 and SCF were purchased from PeproTech (Rocky Hill, NJ). Human TGFβ1, TGFβ2, TGFβ3 and IL-33 were purchased from BioLegend (San Diego, CA). Antibodies against actin were purchased from Sigma-Aldrich (St. Louis, MO). Rat anti-mouse FcγRII/RIII (2.4G2), FITC-conjugated rat IgG isotype control, and FITC-conjugated anti-mouse CD117 (c-Kit) were purchased from BD Pharmingen. Anti-mouse T1/ST2 monoclonal antibody (clone DJ8), FITC-conjugated or PE-conjugated rat IgG2b isotype control, PE-conjugated anti-mouse CD63, APC-conjugated anti-mouse CD107a, and PE-conjugated anti-mouse IgE were purchased from eBioscience (San Diego, CA). Antibodies against phospho- and total Akt, ERK, IKB, p38 and JNK Abs were purchased from Cell Signaling (Danvers, MA).

Cytokine mRNA RT-qPCR

BMMC were cultured with or without 10ng/ml of TGFβ1 for 3 days prior to IL-33 stimulation for 2 hours. Cells were harvested and total RNA was extracted with TRIzol reagent (Life Technologies, Grand Island, NY). RNA was quantified using the Thermo Scientific NanoDrop™ 1000 UV–vis Spectrophotometer (Thermo Scientific, Waltham, MA) according to the manufacturer’s recommended protocol. cDNA was synthesized using the qScript™ cDNA Synthesis from Quanta Biosciences (Gaithersburg, MD). BioRad CFX96 Touch™ Real-Time PCR Detection System (Hercules, CA) was used to amplify message using PerfeCTa SYBR Green SuperMix (Quantabio, Gaithersburg, MD). Primers for IL-6 (forward: 5′TCCAGTTGCCTTCTTGGGAC3′, reverse: TCCAGTTGCCTTCTTGGGAC3′), IL-13 (forward: 5′ ATGGCGCTCTGGGTGACTGCAGTCC, reverse: 5′GAAGGGGCCGTGGCGAAACAGTTGC), TNF (forward: 5′AGCACAGAAAGCATCATCCGC3′, Reverse: 5′TGCCACAAGCAGGAATGAGAAG3′), β-actin (forward: 5′GATGACGATATCGCTGCGC3′, Reverse: 5′CTCGTCACCCACATAGGAGTC3′), were purchased from Eurofins MWG Operon (Huntsville, AL). Amplification conditions consisted of a heat-activation step at 95°C for 2 minutes followed by 40 cycles of 95°C for 15 seconds, 55°C for 30 seconds and 60°C for 1 minute. All melting curve analysis was performed between 50°C and 95°C. Results were normalized to housekeeping genes using Livak Method.

Enzyme–linked immunosorbent assay (ELISA)

Cytokine ELISA kits were purchased from BioLegend (San Diego, CA) and followed the manufacturer’s protocol. Human IL-6, TNF, and MCP-1 ELISA kits (BD OptEIA) were purchased from BD Biosciences (Franklin Lakes, NJ).

Flow cytometric analysis

Surface and intracellular staining (ICS) were performed using standard flow cytometry protocols and analyzed using a BD FACSCalibur (BD Biosciences, Franklin Lakes, NJ). Mast cells were identified as FcεRI^/Kit^{. For cytokine measurements, cells were first activated for 90 min with IL-33, and then cultured for 6–8 h in the presence of 5 μM monensin at 37°C, before fixation in PBS with 4% paraformaldehyde, and staining in the presence of 0.5% saponin.}

Western blot analysis

Western blotting was performed using 30–50 μg total cellular protein per sample. Protein was loaded and separated over 4–20% gradient SDS polyacrylamide gels (Bio-Rad, Hercules, CA). Proteins were transferred to nitrocellulose (Pall Corporation, Ann Arbor, MI), and blocked for 60 min in 0.1% casein in TBS. Blots were incubated in 0.1% casein/TBS-T with a 1:1000 dilution of primary antibody overnight at 4°C with gentle rocking. Blots were washed six times for 5 min each in TBS-T, and then incubated with infrared-labeled secondary antibodies at 1:15,000 final dilution. in Blocker^{Casein in TBS with 0.1% TWEEN}^{20 and incubated at room temperature for 1 hour with gentle rocking. Blots were visualized and quantified using a LiCor Odyssey CLx Infrared imaging system (Lincoln, NE). After background subtraction, fluorescence intensity for the protein of interest was normalized to the signal intensity for the relevant loading control, using Image Studio 4.0 (Li-Cor, Lincoln, Nebraska).}

Luciferase assay

BMMC (3×10^{/condition) were transfected with 1.2μg of pGL4.74[hR}luc/TK] vector encoding luciferase gene from Renilla reniformis under HSV-TK promoter and 6μg of either pGL4.44[luc2p/AP1 RE/Hygro] or pGL4.32[luc2p/NFκB RE/Hygro] vector encoding luciferase gene from Photinus pyralis (Firefly) under AP-1 and NFκB response elements, respectively. All transfection experiments were done using Amaxa Nucleofector from Lonza (Allendale, NJ) with program T-5 in Dulbecco’s modified Eagle’s medium with 20% FBS and 50 mM HEPES (pH 7.5). Cells were used 48-hours post-transfection. Luciferase activity among the lysates was measured using Dual-Luciferase Reporter Assay System, by the GloMax 20/20 luminometer, program DLR-2-INJ.

TGFβ1 injection

Mice (C57BL/6J, 8–12 wk old, n = 5/group) were injected intraperitoneally with 0.5 μg TGFβ1or PBS twice daily for 3 days and once on day 4. One hour later, IL-33 (1μg) was injected intraperitoneally. Six hours after IL-33 injection, cardiac puncture was performed to collect blood and prepare plasma, from which cytokine levels were quantified by ELISA.

Human mast cell culture and stimulation

Protocols involving human tissues were approved by the human studies Internal Review Board at the University of South Carolina. Surgical skin samples were obtained from the Cooperative Human Tissue Network of the National Cancer Institute. Skin MCs were isolated and cultured as described previously (21) and were used after 6–12 weeks. Mast cell purity was determined to be 100% by toluidine blue staining. When applicable, human mast cells were sensitized 24 hour prior to the antigen (Ag) stimulation with the addition of 1 μg/ml DNP-specific mouse IgE (a gift from Dr. Daniel Conrad, VCU), washed to remove excess unbound IgE, and stimulated with 50 ng/ml DNP-HSA (Ag), for 16 hours. Where indicated, recombinant human TGFβ1 (10 ng/ml, BioLegend) was applied for 3 days prior to Ag stimulation and recombinant human IL-33 (100 ng/ml, BioLegend) was added at the same time as Ag. All supernatants were collected after 16 hours of stimulation. Each experimental condition was performed in triplicate determinations from 5 different donors.

Statistics

Data shown in each figure are the mean and standard errors of the indicated number of samples. For comparisons of two samples, Student’s t–Test was used. For comparisons of multiple samples to a control group, one–way analysis of variance (ANOVA) was employed.

Animals

Mouse mast cell cultures

Cytokines and reagents

Cytokine mRNA RT-qPCR

Enzyme–linked immunosorbent assay (ELISA)

Flow cytometric analysis

Western blot analysis

Luciferase assay

TGFβ1 injection

Human mast cell culture and stimulation

Statistics

Results

TGFβ1 suppresses IL-33-mediated cytokine production by mouse mast cells

We previously found that TGFβ1 selectively suppresses development, survival, and IgE-mediated cytokine production from bone marrow derived mast cells (BMMC) (19, 20, 31, 32), and that the 129/SvJ mouse strain is resistant to these inhibitory effects (19). In this work we investigated these effects on mast cells stimulated with IL-33. Mouse BMMC were cultured in the presence or absence of TGFβ1 prior to IL-33 stimulation. TGFβ1 significantly suppressed TNF production among C57BL/6J BMMC, with an IC₅₀ of approximately 0.6 ng/ml and maximal suppression after 3 days of TGFβ1 exposure (Figures 1A, 1B). We also found significant reductions in IL-33-induced IL-6 and IL-13 mRNA among cells cultured with TGFβ1 (Figure 1C). TNF mRNA was induced much less than IL-6 and IL-13, and did not change with TGFβ1 culture (data snot shown). We further noted suppression of both TNF and IL-6 production in 129/SvJ, C3H/HeJ and BALB/cJ BMMC, suggesting that strain variations do not hamper TGF-mediated effects in the context of IL-33 signaling. Intracellular staining and flow cytometry demonstrated significantly lower percentages of TGFβ1-treated cells producing TNF, IL-6, IL-13, and MIP-1α (Figure 1D). These data suggested that diminished cytokine secretion was due to reduced production, not lack of secretion. Finally, all three TGFβ isoforms provided similar inhibitory effects, reducing IL-33-induced cytokine production by C57BL/6J BMMC (supplementary Figure 1). These data indicate that TGFβ family members can antagonize IL-33-induced mast cell activation in vitro.

An external file that holds a picture, illustration, etc.
Object name is nihms880473f1.jpg

Figure 1

TGFβ1 suppresses IL-33-mediated cytokine production in mouse BMMC

C57BL/6J BMMC were cultured in IL-3 and SCF (10ng/mL) and pre-treated with TGFβ1 prior to IL-33 activation. Supernatants were collected 16 hours later. A) Dose response after 3 days of TGFβ1 exposure. B) Time course, using 10ng/ml TGFβ1. C) C57BL/6J BMMC were cultured with 10ng/ml TGFβ1 for 3 days prior to IL-33 stimulation for 2 hours. RT-qPCR was used to measure mRNA expression of IL-6 and IL-13. D) BMMC from the indicated mouse strains were cultured for 3 days in IL-3+SCF, ±TGFβ1 (all cytokines at 10ng/ml) prior to activation with IL-33 (50ng/mL) for 16 hours. Cytokine levels were determined by ELISA. E) In-cell staining of indicated cytokines elicited by IL-33 activation (50ng/mL). BMMC from the indicated mouse strains were cultured as in 1A, and assessed by flow cytometry as described in Materials and Methods. Data shown are mean±SE, representative of at least six independent BMMC populations analyzed in triplicate. *P≤0.05, **P≤0.01, ***P≤0.001, ****P≤0.0001.

TGFβ1 suppresses IgE-induced degranulation and cytokine secretion in the presence of IL-33

IL-33 enhances some IgE-mediated mast cell activation (REF). To determine if TGFb1 can reduce mast cell function induced by both stimuli, we cultured C57BL/6J BMMC for 3 days in the presence or absence of TGFβ1. On day 2 of culture, IgE was added overnight, followed by antigen-mediated crosslinkage (IgE XL) for 16 hours. As shown in Figure 2A, IgE induced robust degranulation, as measured by surface expression of the lysosomal/granule proteins CD107a and CD63. IL-33 did not enhance this effect under the culture conditions used. TGFβ1 significantly suppressed CD107a and CD63 expression. IL-33 increased IgE-induced IL-6 secretion (p<.0001 by ANOVA) and yielded a trend towards increasing MCP-1 production (p=0.11) (Figure 2B). TGFβ1 reduced secretion of both cytokines under all conditions. These data support the conclusion that TGFβ1 suppresses mast cell functions induced by IL-33 or IgE, two critical factors involved in the atopic response.

An external file that holds a picture, illustration, etc.
Object name is nihms880473f2.jpg

Figure 2

TGFb1 suppresses BMMC function in response to IL-33 and IgE XL

C57BL/6J BMMC were cultured for three days in IL-3 and SCF ±TGFβ1 (all at 10ng/ml). IgE (0.5μg/ml) was added on day 2 where indicated. Cells were stimulated with 50ng/ml DNP-HSA to activate IgE (IgE XL) and IL-33 (50ng/ml) for 15 minutes in (A) or 16 hours in (B). Surface CD107a and CD63 were measured by flow cytometry. Cytokines were measured by ELISA. Data shown are from 3 (A) or 2 (B) independent BMMC populations. *P≤0.05, **P≤0.01, ***P≤0.001, ****P≤0.0001, when comparing TGFβ1-treated to control-treated samples.

TGFβ1 suppresses T1/ST2 expression

Reduced cytokine production could be the result of diminished IL-33 receptor expression. We previously observed TGFβ1-mediated FcεRI downregulation on mature mast cells (20) and reduced T1/ST2 expression on developing mast cells cultured with TGFβ1 (31). To determine if TGFb1 suppresses surface T1/ST2 expression on differentiated mast cells, C57BL/6 BMMC were cultured for 3 days in the presence or absence of TGFβ1, and surface T1/ST2 expression was measured by flow cytometry. As shown in Figure 3A, TGFβ1 modestly but consistently suppressed T1/ST2 surface expression. To determine if decreased T1/ST2 explains reduced cytokine production, surface T1/ST2 staining was paired with intracellular cytokine staining among IL-33-activated mast cells cultured +/− TGFβ1. Among T1/ST2-hi cells gated as shown in Figure 3B, the amount of TNF and IL-6 detected was consistently lower in the TGFβ1-treated group (Figure 3C). Thus even among a sub-population of cells retaining high T1/ST2 expression, TGFβ1 still suppressed cytokine synthesis. This indicated that modest receptor downregulation does not explain TGFβ1effects, prompting a study of T1/ST2 signaling.

An external file that holds a picture, illustration, etc.
Object name is nihms880473f3.jpg

Figure 3

T1/ST2 suppression does not explain reduced cytokine production

C57BL/6J BMMC were cultured for three days in IL-3 and SCF ±TGFβ1 (all at 10ng/ml). (A) Cells were stained with anti-T1/ST2 and analyzed by flow cytometry. (B and C) Cells were activated with IL-33 to detect intracellular cytokine production as described in Materials and Methods. Flow cytometry was used to gate on surface T1/ST2-hi BMMC, which were also stained intracellularly with anti-TNF or anti-IL-6. (B) shows represented gating of T1/ST2-hi cells. (C) shows geometric mean fluorescent intensity of TNF or IL-6 staining among T1/ST2-hi cells. Data shown are mean gMFI±SE from (A) triplicate samples of at least 2 separate experiments or (B and C) 18 samples from 2 independent experiments. *P≤0.05, **P≤0.01, ***P≤0.001, ****P≤0.0001.

TGFβ1 suppresses IL-33-mediated signaling and transcription factor activation

T1/ST2 triggering by IL-33 activates a signaling cascade leading to Akt and MAP kinases that ultimately activate the NFκB and AP-1 transcription factors (6–8). We investigated the ability of TGFβ1 to suppress IL-33-induced function of these proteins. C57BL/6J BMMC treated with TGFβ1 for three days showed near-complete loss of Akt and ERK phosphorylation. In contrast, p38 phosphorylation was enhanced, while JNK was unchanged (Figure 4). These findings indicate that TGFβ1 selectively alters IL-33 signaling.

An external file that holds a picture, illustration, etc.
Object name is nihms880473f4.jpg

Figure 4

TGFβ1 selectively alters IL-33-mediated signaling

C57BL6J BMMC cultured for three days in IL-3 and SCF (10ng/ml) ±TGFβ1 (10ng/ml), were activated with IL-33 (200ng/mL) for the indicated times. Lysates were analyzed by Western blotting. Phospho-proteins were normalized to total protein levels using the Li-Cor Odyssey software Image Studio 4.0. Representative blots are shown alongside graphs depicting data from three independent BMMC populations, showing mean±SE. *P≤0.05, **P≤0.01, ***P≤0.001, ****P≤0.0001

If altered upstream phosphorylation events are functionally important, they should result in diminished NFκB- and AP-1-mediated transcription, critical signals for IL-33-mediated cytokine production (6–8). In fact, BMMC transfected with NFκB- or AP1-dependent luciferase reporter plasmids demonstrated reduced activity in the presence of TGFβ1 (Figure 5). These data support the hypothesis that TGFβ1 suppresses T1/ST2-mediated signaling cascades critical for cytokine production.

An external file that holds a picture, illustration, etc.
Object name is nihms880473f5.jpg

Figure 5

TGFβ1 suppresses IL-33-induced NFκB and AP-1 transcriptional activity

C57BL6J BMMC were treated +/− TGFβ1 for 24 hours, after which cells were transfected with a control renilla vector and a firefly vector that encoded the luciferase gene controlled by either AP-1 or NFκB response elements. Cells were then cultured +/− TGFβ1 for two days and activated with IL-33 (100ng/mL) for two hours. Lysates were collected and analyzed as described in Materials and Methods. Data are representative of three total BMMC populations analyzed in two independent experiments with mean±SE. *P≤0.05, **P≤0.01, ***P≤0.001, ****P≤0.0001

TGFβ1 suppresses IL-33-mediated cytokine production in vivo

To determine the effects of TGFβ1 in vivo, C57BL/6J mice were injected intraperitoneally with TGFβ1 twice daily for 3 days and once on the 4^{day. TGFβ1 had no effect on basal plasma IL-33 or soluble ST2 levels, which were less than 15pg/ml (}Supplemental Figure 2). One hour after the final TGFβ1 injection, IL-33 was administered through intraperitoneal injection. After four hours, plasma cytokine levels were measured by ELISA. IL-33 injection increased circulating IL-6, IL-13, and MCP-1. TGFβ1-treated mice had lower levels of all three cytokines relative to mice injected with PBS alone (Figure 6). These in vivo data support our in vitro finding that TGFβ1 is a potent inhibitor of IL-33-mediated signaling.

An external file that holds a picture, illustration, etc.
Object name is nihms880473f6.jpg

Figure 6

TGFβ1 suppresses IL-33-mediated cytokine production in vivo

TGFβ1 (0.5μg) or PBS were injected intraperitoneally twice daily for 3 days and once on the fourth day prior to intraperitoneal injection of IL-33 (1μg). 4 hours after IL-33 injections, mice were euthanized and blood was collected via cardiac puncture, from which plasma was isolated. Cytokine profile was determined by ELISA. Data shown are from 5 animals per group with mean±SE, from one of two independent experiments. *P≤0.05, **P≤0.01, ***P≤0.001, ****P≤0.0001.

TGFβ1 suppresses IL-33-mediated activation of human mast cells

To determine if the effects of TGFβ1 were consistent in the human system, skin-derived mast cells from five donors were cultured for three days in the presence or absence of TGFβ1 prior to overnight activation. Because IL-33 is a weak stimulus for human mast cells, we activated cells with IL-33 alone and also assessed IL-33-mediated augmentation of IgE signaling. As shown in Figure 7, TGFβ1 significantly reduced IL-33-mediated MCP-1 and IL-6 secretion. Further, TGFβ1 suppressed IgE-mediated cytokine production as we have previously reported (19, 20), and blunted the enhancing effects of IL-33, similar to our findings with BMMC. These data support the hypothesis that TGFβ1 can act on both murine and human mast cells to suppress inflammatory responses.

An external file that holds a picture, illustration, etc.
Object name is nihms880473f7.jpg

Figure 7

TGFβ1 suppresses cytokine production from human skin mast cells

Human skin mast cells were pretreated +/− TGFβ1 for 3 days prior to 16-hour stimulation with IL-33. In addition, IgE/Ag stimulation (IgE XL) was conducted during IL-33 stimulation where indicated. Cytokines were measured by ELISA. Each icon represents the mean of six replicate samples from an individual donor, while bars show the mean+/− SE from the set of donors (N=5). *P≤0.05, **P≤0.01, ***P≤0.001, ****P≤0.0001.

TGFβ1 suppresses IL-33-mediated cytokine production by mouse mast cells

Figure 1

TGFβ1 suppresses IL-33-mediated cytokine production in mouse BMMC

TGFβ1 suppresses IgE-induced degranulation and cytokine secretion in the presence of IL-33

Figure 2

TGFb1 suppresses BMMC function in response to IL-33 and IgE XL

TGFβ1 suppresses T1/ST2 expression

Figure 3

T1/ST2 suppression does not explain reduced cytokine production

TGFβ1 suppresses IL-33-mediated signaling and transcription factor activation

Figure 4

TGFβ1 selectively alters IL-33-mediated signaling

Figure 5

TGFβ1 suppresses IL-33-induced NFκB and AP-1 transcriptional activity

TGFβ1 suppresses IL-33-mediated cytokine production in vivo

Figure 6

TGFβ1 suppresses IL-33-mediated cytokine production in vivo

TGFβ1 suppresses IL-33-mediated activation of human mast cells

Figure 7

TGFβ1 suppresses cytokine production from human skin mast cells

Discussion

Mast cells are known as key regulators of the allergic response. While IgE-induced activation has been the focus of many studies, there is a new appreciation for other allergy-related mast cell activators. IL-33 has received considerable attention in this regard. Its elevated expression in asthmatic patients and in mouse asthma models, coupled with evidence that blocking IL-33 or T1/ST2 reduces inflammation and airway hyperresponsiveness in mouse models (11–15) has made IL-33 a major focus of asthma research. It is clear that IL-33 induces mast cells to produce Th2-type cytokines, factors that sustain allergy (5). However, natural controls on IL-33 signaling are poorly understood. For this reason, we sought to identify feedback regulators promoting mast cell homeostasis, including those targeting IL-33.

Previous studies identified polymorphisms in the TGFβ1 locus that segregate with allergy and asthma (33–37). The suspicion that TGFβ1 might contribute to allergic disease prompted investigations into its effects on IgE-mediated mast cell responses. We and others previously noted TGFβ1-mediated suppressive effects on mast cells, including decreased IgE-mediated cytokine production in vitro and in vivo (18–20), diminished proliferation and survival (31, 32), and reduced c-Kit and FcεRI expression (19, 20). However, TGFβ1 is not entirely suppressive to mast cells, as it elicits their adhesion and migration (38–42). Importantly, these effects might be augmented by mast cells in an autocrine fashion, since proteases released during degranulation can cleave and activate latent TGFβ1 in the tissues (29, 30). Similarly, chymases and tryptases in mast cell granules can digest IL-33, generating inflammatory peptides that activate type 2 innate lymphoid cells (43–45). Thus mast cell degranulation can augment the effects of both TGFβ1 and IL-33. These effects emphasize the importance of TGFβ1 suppressing IgE-induced degranulation even in the presence of IL-33. In the context of these atopic-promoting factors, we propose that TGFβ1 serves as a homeostatic regulator, limiting mast cell-mediated inflammation.

It was unexpected that TGFβ1 could suppress IL-33-mediated cytokine production from BMMC across multiple mouse strains, since our previous study found that TGFβ1 suppressed IgE-mediated inflammatory cytokine secretion from C57BL/6J but not 129/SvJ BMMC (19). The current data show no such variation among C57BL/6, 129SvJ, C3H/HeJ, and BALB/c BMMC. In our previous work, we found that TGFβ1 suppressed Fyn and Stat5 expression, but that 129/SvJ BMMC have higher basal Fyn and Stat5 expression, rendering them TGF-resistant in regard to IgE signaling (19). However, IL-33 signaling does not activate Fyn or Stat5, possibly explaining the lack of strain variability in the current work. This may have clinical import. Human skin mast cells showed variable TGFβ1 responses when we measured IgE-induced cytokine secretion (19) – but in this study, TGFβ1 similarly suppressed IL-33 effects on cells from five donors. Given the growing understanding of IL-33 function in allergic disease, basic knowledge of how IL-33 regulation is accomplished will be critical to targeting this pathway.

TGFβ1 modestly reduced T1/ST2 surface expression. However, further study of this effect led us to conclude that decreased receptor expression is not a root cause of TGFβ1 effects. Even among sub-populations maintaining high T1/ST2 expression, cytokine synthesis was still inhibited. These data supported the hypothesis that reduced T1/ST2 expression was less important than disrupted receptor signaling. Our survey of IL-33-mediated signaling events showed TGFβ1 essentially ablated Akt and ERK activation, while increasing p38 and leaving JNK phosphorylation unchanged. Increased p38 phosphorylation should be anticipated, since TGFβ1 activates p38 in both hematopoietic and non-hematopoeitic cells (46–48). Akt and ERK are well known upstream activators of NFκB and AP-1, two transcription factors whose activity was suppressed by TGFβ1 in our study. Because both protein families are known to regulate T1/ST2-induced function, these effects of TGFβ1 are significant.

These in vitro data translated well to in vivo and human models. We noted significant reductions in systemic IL-6, IL-13, and MCP-1 when mice were injected with TGFβ1 prior to IL-33 challenge. Importantly, these in vivo data do not allow us to state that TGFβ1 is acting on mast cells per se, as many other lineages express T1/ST2. However, the results are in keeping with the current understanding of how mast cells contribute to systemic IL-33 responses (49) and suggest that TGFβ1 may inhibit IL-33 activation more broadly. We previously found that TGFβ1 injections performed in the same manner reduced peritoneal but not intestinal or skin mast cell numbers (19). Therefore, reduced cytokine production could be partly due to a diminished mast cell population in addition to inhibitory effects on T1/ST2 signaling.

In summary, our data demonstrate that TGFβ proteins, and in particular TGFβ1, are potent antagonists of IL-33-induced mast cell function. Through in vitro and in vivo studies using mouse and human cells, these results show that TGFβ1 diminishes IL-33-mediated Akt and ERK activation, coupled with poor transcriptional induction of inflammatory cytokines. The lack of overt genotypic restrictions on these effects supports further study of TGFβ1 and its downstream signaling events as ways to control mast cell homeostasis in allergic and inflammatory disease.

Supplementary Material

1

Click here to view.^{(122K, pdf)}

1

Click here to view.^{(122K, pdf)}

Acknowledgments

This work was supported by National Institutes of Health grants 1R01AI59638 and 1R01AI101153 to JJR; 1R01AI095494 and 1R21 {"type":"entrez-nucleotide","attrs":{"text":"AR067996","term_id":"5999218","term_text":"AR067996"}}AR067996 to CAO.

^{Department of Biology, Virginia Commonwealth University, Richmond, VA, 23284}

^{Department of Biomedical Engineering, Virginia Commonwealth University, Richmond, VA, 23284}

^{Department of Pathology, Microbiology, and Immunology, University of South Carolina School of Medicine, Columbia, SC, 29208}

To whom correspondence should be addressed: John J. Ryan, Ph.D., Department of Biology, Virginia Commonwealth University, Box 842102, Richmond, VA 23284-2012, Tel: 804-828-0712; Fax: 804-828-0503; ude.ucv@nayrjj

^{These authors contributed equally to this work.}

Abstract

TGFβ1 is involved in many pathological conditions, including autoimmune disorders, cancer, cardiovascular and allergic diseases. We have previously found that TGFβ1 can suppress IgE-mediated mast cell activation of human and mouse mast cells. IL-33 is a member of the IL-1 family capable of inducing mast cell responses and enhancing IgE-mediated activation. In this study, we investigated the effects of TGFβ on IL-33-mediated mast cell activation. Bone marrow-derived mast cells cultured in TGFβ −1, −2, or −3 showed reduced IL-33-mediated production of TNF, IL-6, IL-13 and MCP-1, in a concentration-dependent manner. TGFβ1 inhibited IL-33-mediated Akt and ERK phosphorylation as well as NFκB- and AP-1-mediated transcription. These effects were functionally important, as TGFβ1 injection suppressed IL-33-induced systemic cytokines in vivo and inhibited IL-33-mediated cytokine release from human mast cells. TGFβ1 also suppressed the combined effects of IL-33 and IgE-mediated activation on mouse and human mast cells. The role of IL-33 in the pathogenesis of allergic diseases is incompletely understood. These findings, consistent with our previously reported effects of TGFβ1 on IgE-mediated activation, demonstrate that TGFβ1 can provide broad inhibitory signals to activated mast cells.

Keywords: TGF, IL-33, mast cell, inflammation

Abstract

References

1. Draber P, Halova I, Polakovicova I, Kawakami TSignal transduction and chemotaxis in mast cells. Eur J Pharmacol. 2016;778:11–23.[Google Scholar]
2. Galli SJ, Tsai M, Marichal T, Tchougounova E, Reber LL, Pejler GApproaches for analyzing the roles of mast cells and their proteases in vivo. Adv Immunol. 2015;126:45–127.[Google Scholar]
3. Oettgen HC, Burton OTIgE and Mast Cells: The Endogenous Adjuvant. Adv Immunol. 2015;127:203–256.[PubMed][Google Scholar]
4. Cayrol C, Girard JPIL-33: an alarmin cytokine with crucial roles in innate immunity, inflammation and allergy. Curr Opin Immunol. 2014;31:31–37.[PubMed][Google Scholar]
5. Saluja R, Khan M, Church MK, Maurer MThe role of IL-33 and mast cells in allergy and inflammation. Clin Transl Allergy. 2015;5:33.[Google Scholar]
6. Ali S, Huber M, Kollewe C, Bischoff SC, Falk W, Martin MUIL-1 receptor accessory protein is essential for IL-33-induced activation of T lymphocytes and mast cells. Proc Natl Acad Sci U S A. 2007;104:18660–18665.[Google Scholar]
7. Chackerian AA, Oldham ER, Murphy EE, Schmitz J, Pflanz S, Kastelein RAIL-1 receptor accessory protein and ST2 comprise the IL-33 receptor complex. J Immunol. 2007;179:2551–2555.[PubMed][Google Scholar]
8. Schmitz J, Owyang A, Oldham E, Song Y, Murphy E, McClanahan TK, Zurawski G, Moshrefi M, Qin J, Li X, Gorman DM, Bazan JF, Kastelein RAIL-33, an interleukin-1-like cytokine that signals via the IL-1 receptor-related protein ST2 and induces T helper type 2-associated cytokines. Immunity. 2005;23:479–490.[PubMed][Google Scholar]
9. Bertheloot D, Latz EHMGB1, IL-1alpha, IL-33 and S100 proteins: dual-function alarmins. Cell Mol Immunol 2016[Google Scholar]
10. Hardman C, Ogg GInterleukin-33, friend and foe in type-2 immune responses. Curr Opin Immunol. 2016;42:16–24.[PubMed][Google Scholar]
11. Coyle AJ, Lloyd C, Tian J, Nguyen T, Erikkson C, Wang L, Ottoson P, Persson P, Delaney T, Lehar S, Lin S, Poisson L, Meisel C, Kamradt T, Bjerke T, Levinson D, Gutierrez-Ramos JCCrucial role of the interleukin 1 receptor family member T1/ST2 in T helper cell type 2-mediated lung mucosal immune responses. J Exp Med. 1999;190:895–902.[Google Scholar]
12. Kearley J, Buckland KF, Mathie SA, Lloyd CMResolution of allergic inflammation and airway hyperreactivity is dependent upon disruption of the T1/ST2-IL-33 pathway. Am J Respir Crit Care Med. 2009;179:772–781.[Google Scholar]
13. Kurowska-Stolarska M, Stolarski B, Kewin P, Murphy G, Corrigan CJ, Ying S, Pitman N, Mirchandani A, Rana B, van Rooijen N, Shepherd M, McSharry C, McInnes IB, Xu D, Liew FYIL-33 amplifies the polarization of alternatively activated macrophages that contribute to airway inflammation. J Immunol. 2009;183:6469–6477.[PubMed][Google Scholar]
14. Liu X, Li M, Wu Y, Zhou Y, Zeng L, Huang TAnti-IL-33 antibody treatment inhibits airway inflammation in a murine model of allergic asthma. Biochem Biophys Res Commun. 2009;386:181–185.[PubMed][Google Scholar]
15. Prefontaine D, Lajoie-Kadoch S, Foley S, Audusseau S, Olivenstein R, Halayko AJ, Lemiere C, Martin JG, Hamid QIncreased expression of IL-33 in severe asthma: evidence of expression by airway smooth muscle cells. J Immunol. 2009;183:5094–5103.[PubMed][Google Scholar]
16. Ho LH, Ohno T, Oboki K, Kajiwara N, Suto H, Iikura M, Okayama Y, Akira S, Saito H, Galli SJ, Nakae SIL-33 induces IL-13 production by mouse mast cells independently of IgE-FcepsilonRI signals. J Leukoc Biol. 2007;82:1481–1490.[PubMed][Google Scholar]
17. Silver MR, Margulis A, Wood N, Goldman SJ, Kasaian M, Chaudhary DIL-33 synergizes with IgE-dependent and IgE-independent agents to promote mast cell and basophil activation. Inflamm Res. 2010;59:207–218.[PubMed][Google Scholar]
18. Bissonnette EY, Enciso JA, Befus ADTGF-beta1 inhibits the release of histamine and tumor necrosis factor-alpha from mast cells through an autocrine pathway. Am J Respir Cell Mol Biol. 1997;16:275–282.[PubMed][Google Scholar]
19. Fernando J, Faber TW, Pullen NA, Falanga YT, Kolawole EM, Oskeritzian CA, Barnstein BO, Bandara G, Li G, Schwartz LB, Spiegel S, Straus DB, Conrad DH, Bunting KD, Ryan JJGenotype-dependent effects of TGF-beta1 on mast cell function: targeting the Stat5 pathway. J Immunol. 2013;191:4505–4513.[Google Scholar]
20. Gomez G, Ramirez CD, Rivera J, Patel M, Norozian F, Wright HV, Kashyap MV, Barnstein BO, Fischer-Stenger K, Schwartz LB, Kepley CL, Ryan JJTGF-beta 1 inhibits mast cell Fc epsilon RI expression. J Immunol. 2005;174:5987–5993.[Google Scholar]
21. Zhao W, Gomez G, Yu SH, Ryan JJ, Schwartz LBTGF-beta1 attenuates mediator release and de novo Kit expression by human skin mast cells through a Smad-dependent pathway. J Immunol. 2008;181:7263–7272.[Google Scholar]
22. Malhotra N, Kang JSMAD regulatory networks construct a balanced immune system. Immunology. 2013;139:1–10.[Google Scholar]
23. Sanjabi S, Zenewicz LA, Kamanaka M, Flavell RAAnti-inflammatory and pro-inflammatory roles of TGF-beta, IL-10, and IL-22 in immunity and autoimmunity. Curr Opin Pharmacol. 2009;9:447–453.[Google Scholar]
24. Akdis M, Aab A, Altunbulakli C, Azkur K, Costa RA, Crameri R, Duan S, Eiwegger T, Eljaszewicz A, Ferstl R, Frei R, Garbani M, Globinska A, Hess L, Huitema C, Kubo T, Komlosi Z, Konieczna P, Kovacs N, Kucuksezer UC, Meyer N, Morita H, Olzhausen J, O’Mahony L, Pezer M, Prati M, Rebane A, Rhyner C, Rinaldi A, Sokolowska M, Stanic B, Sugita K, Treis A, van de Veen W, Wanke K, Wawrzyniak M, Wawrzyniak P, Wirz OF, Zakzuk JS, Akdis CAInterleukins (from IL-1 to IL-38), interferons, transforming growth factor beta, and TNF-alpha: Receptors, functions, and roles in diseases. J Allergy Clin Immunol 2016[PubMed][Google Scholar]
25. Weiss A, Attisano LThe TGFbeta superfamily signaling pathway. Wiley Interdiscip Rev Dev Biol. 2013;2:47–63.[PubMed][Google Scholar]
26. Lee YK, Mukasa R, Hatton RD, Weaver CTDevelopmental plasticity of Th17 and Treg cells. Curr Opin Immunol. 2009;21:274–280.[PubMed][Google Scholar]
27. Ziegler SF, Buckner JHFOXP3 and the regulation of Treg/Th17 differentiation. Microbes Infect. 2009;11:594–598.[Google Scholar]
28. Khan SA, Joyce J, Tsuda TQuantification of active and total transforming growth factor-beta levels in serum and solid organ tissues by bioassay. BMC Res Notes. 2012;5:636.[Google Scholar]
29. Lindstedt KA, Wang Y, Shiota N, Saarinen J, Hyytiainen M, Kokkonen JO, Keski-Oja J, Kovanen PTActivation of paracrine TGF-beta1 signaling upon stimulation and degranulation of rat serosal mast cells: a novel function for chymase. FASEB J. 2001;15:1377–1388.[PubMed][Google Scholar]
30. Taipale J, Lohi J, Saarinen J, Kovanen PT, Keski-Oja JHuman mast cell chymase and leukocyte elastase release latent transforming growth factor-beta 1 from the extracellular matrix of cultured human epithelial and endothelial cells. J Biol Chem. 1995;270:4689–4696.[PubMed][Google Scholar]
31. Kashyap M, Bailey DP, Gomez G, Rivera J, Huff TF, Ryan JJTGF-beta1 inhibits late-stage mast cell maturation. Exp Hematol. 2005;33:1281–1291.[PubMed][Google Scholar]
32. Norozian F, Kashyap M, Ramirez CD, Patel N, Kepley CL, Barnstein BO, Ryan JJTGFbeta1 induces mast cell apoptosis. Exp Hematol. 2006;34:579–587.[PubMed][Google Scholar]
33. Chiang CH, Chuang CH, Liu SL, Shen HDGenetic polymorphism of transforming growth factor beta1 and tumor necrosis factor alpha is associated with asthma and modulates the severity of asthma. Respir Care. 2013;58:1343–1350.[PubMed][Google Scholar]
34. Hatsushika K, Hirota T, Harada M, Sakashita M, Kanzaki M, Takano S, Doi S, Fujita K, Enomoto T, Ebisawa M, Yoshihara S, Sagara H, Fukuda T, Masuyama K, Katoh R, Matsumoto K, Saito H, Ogawa H, Tamari M, Nakao ATransforming growth factor-beta(2) polymorphisms are associated with childhood atopic asthma. Clin Exp Allergy. 2007;37:1165–1174.[PubMed][Google Scholar]
35. Hobbs K, Negri J, Klinnert M, Rosenwasser LJ, Borish LInterleukin-10 and transforming growth factor-beta promoter polymorphisms in allergies and asthma. Am J Respir Crit Care Med. 1998;158:1958–1962.[PubMed][Google Scholar]
36. Salam MT, Gauderman WJ, McConnell R, Lin PC, Gilliland FDTransforming growth factor- 1 C-509T polymorphism, oxidant stress, and early-onset childhood asthma. Am J Respir Crit Care Med. 2007;176:1192–1199.[Google Scholar]
37. Ueda T, Niimi A, Matsumoto H, Takemura M, Yamaguchi M, Matsuoka H, Jinnai M, Chin K, Minakuchi M, Cheng L, Shirakawa T, Mishima MTGFB1 promoter polymorphism C-509T and pathophysiology of asthma. J Allergy Clin Immunol. 2008;121:659–664.[PubMed][Google Scholar]
38. Gruber BL, Marchese MJ, Kew RRTransforming growth factor-beta 1 mediates mast cell chemotaxis. J Immunol. 1994;152:5860–5867.[PubMed][Google Scholar]
39. Olsson N, Piek E, Sundstrom M, ten Dijke P, Nilsson GTransforming growth factor-beta-mediated mast cell migration depends on mitogen-activated protein kinase activity. Cell Signal. 2001;13:483–490.[PubMed][Google Scholar]
40. Olsson N, Piek E, ten Dijke P, Nilsson GHuman mast cell migration in response to members of the transforming growth factor-beta family. J Leukoc Biol. 2000;67:350–356.[PubMed][Google Scholar]
41. Rosbottom A, Scudamore CL, von der Mark H, Thornton EM, Wright SH, Miller HRTGF-beta 1 regulates adhesion of mucosal mast cell homologues to laminin-1 through expression of integrin alpha 7. J Immunol. 2002;169:5689–5695.[PubMed][Google Scholar]
42. Wang HW, Tedla N, Hunt JE, Wakefield D, McNeil HPMast cell accumulation and cytokine expression in the tight skin mouse model of scleroderma. Exp Dermatol. 2005;14:295–302.[PubMed][Google Scholar]
43. Lefrancais E, Duval A, Mirey E, Roga S, Espinosa E, Cayrol C, Girard JPCentral domain of IL-33 is cleaved by mast cell proteases for potent activation of group-2 innate lymphoid cells. Proc Natl Acad Sci U S A. 2014;111:15502–15507.[Google Scholar]
44. Roy A, Ganesh G, Sippola H, Bolin S, Sawesi O, Dagalv A, Schlenner SM, Feyerabend T, Rodewald HR, Kjellen L, Hellman L, Abrink MMast cell chymase degrades the alarmins heat shock protein 70, biglycan, HMGB1, and interleukin-33 (IL-33) and limits danger-induced inflammation. J Biol Chem. 2014;289:237–250.[Google Scholar]
45. Waern I, Lundequist A, Pejler G, Wernersson SMast cell chymase modulates IL-33 levels and controls allergic sensitization in dust-mite induced airway inflammation. Mucosal Immunol. 2013;6:911–920.[PubMed][Google Scholar]
46. Hannigan M, Zhan L, Ai Y, Huang CKThe role of p38 MAP kinase in TGF-beta1-induced signal transduction in human neutrophils. Biochem Biophys Res Commun. 1998;246:55–58.[PubMed][Google Scholar]
47. Liao JH, Chen JS, Chai MQ, Zhao S, Song JGThe involvement of p38 MAPK in transforming growth factor beta1-induced apoptosis in murine hepatocytes. Cell Res. 2001;11:89–94.[PubMed][Google Scholar]
48. Yu L, Hebert MC, Zhang YETGF-beta receptor-activated p38 MAP kinase mediates Smad-independent TGF-beta responses. EMBO J. 2002;21:3749–3759.[Google Scholar]
49. Enoksson M, Moller-Westerberg C, Wicher G, Fallon PG, Forsberg-Nilsson K, Lunderius-Andersson C, Nilsson GIntraperitoneal influx of neutrophils in response to IL-33 is mast cell-dependent. Blood. 2013;121:530–536.[PubMed][Google Scholar]