STAT3 is Overactivated in Gastric Cancer Stem-Like Cells
Abstract
Objective
Gastric cancer (GC) is widely associated with chronic inflammation. Thepro inflammatory microenvironment provides conditions that disrupt stem/progenitorcell proliferation and differentiation. The signal transducer and activator of transcrip-tion-3 (STAT3) signaling pathway is involved in inflammation and also contributes tothe maintenance of embryonic stem cell (ESCs) pluripotency. Here, we have investi-gated the activation status of STAT3 in GC stem-like cells (GCSLCs).
Materials and Methods
In this experimental research, CSLCs derived from the humanGC cell line MKN-45 and patient specimens, through spheroid body formation, character-ized and then assayed for the STAT3 transcription factor expression in mRNA and proteinlevel further to its activation.
Results
Spheroid cells showed higher potential for spheroid formation than the pa-rental cells. Furthemore, stemness genes NANOG, c-MYC and SOX-2 were overexpressed in spheroids of MKN-45 and in patient samples. In MKN-45 spheroid cells,epithelial mesenchymal transition (EMT) related markers CDH2, SNAIL2, TWIST andVIMENTIN were upregulated (P<0.05), but we observed no change in expression ofthe E-cadherin epithelial marker. These cells exhibited more resistance to docetaxel(DTX) when compared with parental cells (P<0.05) according to the MTS assay. Al-though immunostaining and Western blotting showed expression of the STAT3 pro-tein in both spheroids and parents, the mRNA level of STAT3 in spheroids was higherthan the parents. Nuclear translocation of STAT3 was accompanied by more intensivephospho-STAT3 (p-STAT3) in spheroid structures relative to the parent cells accord-ing to flow cytometry analysis (P<0.05).
Conclusion
The present findings point to STAT3 over activation in GCSLCs. Com-plementary experiments are required to extend the role of STAT3 in stemness fea-tures and invasion properties of GCSCs and to consider the STAT3 pathway for CSCtargeted therapy.
Introduction
Cancer stem cells (CSCs) are defined as cells capable of giving rise to a new tumor. They are thought to be cancer-initiating cells responsible for cancer relapse and metastasis due to resistance to current therapeutic approaches (1,2). Various efforts to recognize CSCs in many types of cancers provide the opportunity to overcome cancer by targeting specific characteristics of these tumor-initiating cells such as the signaling pathways and their components. Signaling pathways involved in both cancer and stem cells include the Janus kinase (JAK)/signal transducer and activator of transcription-3 (STAT), Hedgehog (Hh), epidermal growth factor (EGF), Notch, mitogen-activated protein kinase (MAP-Kinase)/extracellular signal-regulated kinases (ERK), phosphatidylinositol 3 kinase (PI3K)/acutely transforming retrovirus (AKT), nuclear factor kappa β (NFkβ), Wnt and the transforming growth factor beta (TGF-β) signaling pathways (3,4). However, revealing the signaling networks required for the maintenance of stemness in CSCs can be exploited in cancer treatment. It has been reported that some of these pathways are highly activated in CSCs relative to the bulk of tumors in a wide variety of human cancers.
STAT3, initially identified as a mediator of the inflammation-associated acute phase response, is considered an oncogene (5). Physiologically, STAT3 is activated only transiently. In many cancers, by contrast, STAT3 is constitutively activated in a portion of the tumor bulk, (6) including cancers of the breast, prostate, ovary, pancreas and leukemia (7,11), as well as gastric cancer (GC) (12). The activation state is frequently related to a poor prognosis (13). On the other hand, STAT3 in cooperation with NANOG maintains embryonic stem cell pluripotency (14,15) and is essential for preservation of stemness characteristics, proliferation and tumorigenicity of CSCs in breast cancer and glioblastoma (16,17).
Growing evidences suggest that inflammation promotes epithelial mesenchymal transition (EMT) (18). Numerous observations have also described the role of STAT3 in regulation of cellular proliferation, invasion, migration, and angiogenesis (19). Metastasis accounts for over 90% of cancer mortality (20) and is dependent on EMT and its counterpart process, mesenchymal epithelial transition (MET). CSCs have shown a correlation with the EMT process (21).
In GC, some putative cell surface marker have been introduced to identify CSC subpopulations. Among the most consistent markers are CD44 (22,25), EpCAM (23), CD24 (24), and CD133 (25,26). Side population (SP) cells and spheroid structures from GC cell lines and primary GC tissues have also been proposed as cancer stem-like cells (CSLCs) (23,27,28).
The main purpose of this study was to investigate the level of STAT3 activation subsequent to isolation of CSLCs from GC, which was representative of chronic inflammationinduced cancers. Therefore, GCSLCs were enriched and characterized human GC cell line MKN-45 and patient tumor specimens based on sphere culture. Next we assessed STAT3 activity by examining phospho-STAT3 (p-STAT3), the active form of STAT3. Further confirmation of the present findings might suggest that the STAT3 pathway could be a component of the stemness signaling network in CSCs.
Materials and Methods
The patient gastric adenocarcinoma samples were provided by the Iranian National Tumor Bank, the Cancer Institute of Iran, Imam Hospitals Complex. Informed consents were obtained from participant patients and the Royan Institute’s Institutional Review Board approved the project.
Cultures of cells and tumor tissues
For this experimental research, tumor samples were obtained within 1-2 hours after surgical resection from two adult GC patients (GC 19 and GC 24). Tumor tissues were washed and mechanically dissociated into small (1-2 mm3) fragments. Tissue fragmentsof tumor specimens and the human gastric adenocarcinomacell line MKN-45 were cultured in RoswellPark Memorial Institute medium (RPMI)-1640 supplementedwith 10% fetal bovine serum (FBS, Gibco,USA), 100 U/ml penicillin and 100 μg/ml streptomycin(both from Gibco, USA) as an adherent monolayerculture and were trypsinized to a single cell preparationand further passages. For tissue specimens, 50μg/ml of gentamicin (Sigma, USA) and 0.25 ng/ml ofamphotericin-B (Gibco, USA) were added to the culturemedium. The passage number of cultured cellswas not more than 5.
Gastrosphere formation and spheroid formation efficacy
In order to generate a primary culture of floating spheroids with enriched cancer stem cells, we placed MKN-45 cells at a density of 10000 cells/ml in serum-free RPMI that contained B27 (1:50, Gibco, USA), 20 ng/ml of basic fibroblast growth factor (bFGF, Royan Institute, Iran), and epidermal growth factor (EGF, Royan Institute, Iran) in T-25 non-adhesive poly(2-hydroxyethyl methacrylate) (poly-HEMA, Sigma, USA) coated flasks. Spheroids were passaged approximately every week. The spheroids were dissociated enzymatically with accutase (Gibco, USA) into single cells and their capacity to generate secondary and tertiary gastrospheroids was examined by counting the spheroids larger than 50 μm at the time of passage in 10 visualized fields under a microscope. Fragments of tumor specimen were cultured in the same conditions as MKN-45 to form spheroids. To compare spheroid formation efficacy of adherent culture and spheroids derived from patient samples, single cells were seeded at 2000 cells/ well in six-well ultra-low attachment plates (Corning, USA). After approximately 7 days, the spheroids were counted.
Chemoresistancy by MTS colorimetric cell proliferation assay
In order to prove the increased chemoresistance of spheroids compared to MKN-45 parental cells, we used the MTS assay as described below. Single cells of spheroids and parental cells were treated for 72 hours with docetaxel (DTX, Sigma, USA) at 0.5 μM concentration, which we determined to be the 50% inhibitory concentration (IC50) of DTX on MKN-45 cells. In order to determine the estimated IC50, we seeded single cells (5000 cells/well) of the MKN-45 monolayer culture onto 96-well plates. Cells were treated with different doses (0.5-100 μM) of DTX in triplicate. Dimethyl sulfoxide (DMSO, Sigma, USA), a DTX solvent, was considered the negative control. At 24, 48 and 72 hours post-treatment, 10 μl of MTS solution (Promega, USA) was added to the wells and incubated for 3 hours. Next, we measured the absorbance at 490 nm in order to determine cell viability.
Phospho flow cytometry
Phospho flow cytometry analysis of p-STAT3 was performed in order to examine whether the amount of activated STAT3 was increased in spheroid cells. Dissociated single cell suspensions were prepared enzymatically from adherent and spheroid cultures of MKN-45 and tumor tissue samples, then washed and fixed by the direct addition of phosphate buffered saline (PBS)/paraformaldehyde (PFA) into the culture medium in order to obtain a final concentration of 1.5% PBS/PFA for 10 minutes at room temperature and pelleted. The cells were subsequently permeabilized by suspending with vigorous vortexing in 500 µl ice cold methanol and incubated in ice for 30 minutes. After three times washing in PBS/ bovine serum albumin (BSA) (0.5%), the cells were stained with the primary antibody (monoclonal rabbit anti-pTyr 705-STAT3, 1:100, Cell Signaling) for 45 minutes at room temperature, then washed and incubated with Alexa Fluor-488 labeled goat antirabbit IgG (1:500, Invitrogen, USA) for 30 minutes at 37˚C. Cells stained only with the secondary antibody were considered to be the negative control. Flow cytometry analysis of the cell populations were performed with a BD FACS-Calibur flow cytometer and Flowing software was used for data analyses.
RNA extraction and quantitative real-time polymerase chain reaction
Cells were collected and preserved at -80˚C until RNA extraction. Total RNA was isolated using Trizol reagent (Qiagen, USA) and treated with DNAse I (Fermentas, USA) for 30 minutes in order to digest the genomic DNA. The quality of RNA samples was monitored by agarose gel electrophoresis and a spectrophotometer (Biowave ІІ, UK). A total of 2 μg of RNA was reverse transcribed with a cDNA synthesis kit (Fermentas, USA) and random hexamer primers according to the manufacturer’s instructions. Transcript levels were determined using the SYBR Green master mix (Takara, Japan) and a Rotorgene 6000. Expression of genes involved in stemness features and genes that regulate the process of EMT were normalized to the GAPDH housekeeping gene. Relative quantification of gene expression was calculated using the ∆∆Ct method. Primer sequences for quantitative real-time polymerase chain reaction (qRT–PCR) are listed in table 1.
Primername | Sequence |
---|---|
OCT4 | F:5´GTTCTTCATTCACTAAGGAAGG3´ |
SOX2 | F:5´GGGAAATGGAAGGGGTGCAAAAGAGG3´ |
KLF4 | F:5´ACGATCGTGGCCCCGGAAAAGGACC3´ |
c-MYC | F:5´GCGTCCTGGGAAGGGAGATCCGGAGC3´ |
NANOG | F:5´CAGCTACAAACAGGTGAAGAC3´ |
STAT3 | F:5´GAAGAATCCAACAACGGCAG3´ |
GAPDH | F:5´GAAATCCCATCACCATCTTCC3´ |
CDH1 | F:5´GCTCTCCACTCTTACTTCCT3´ |
CDH2 | F:5´GCCCAAGACAAAGAGACCC3´ |
TWIST1 | F:5´CCAGGTACATCGACTTCCTC3´ |
SNAIL1 | F:5´CCAGAGTTTACCTTCCAGCA3´ |
SNAIL2 | F:5´AACTACAGCGAACTGGACAC3´ |
VIMENTIN | F:5´AAACTTAGGGGCGCTCTTGT3´ |
Immunofluorescent staining of STAT3
Immunocytofluorescent staining was performed to assess the expression of STAT3 at the protein level and its localization. Briefly, MKN-45 cells cultured in 96-well plates were fixed with 4% PFA for 20 minutes at room temperature, washed with PBS/5% Tween, and permeabilized with 0.5 % triton-X100. After washing, the cells were blocked in 10% goat serum/PBS, and stained with polyclonal rabbit anti-STAT3 (1:100, Santa Cruz). Cells were stained with a secondary Alexa Fluor-488 labeled goat anti-rabbit IgG (1:500, Sigma, USA) and counterstained with 1 μg/ml 4,6-diamino2-phenyl indole dihydrochloride (DAPI, Sigma, USA). Cells were visualized using an Olympus fluorescent microscope. In the case of MKN-45 spheroids, paraffin-blocks were prepared from agarose embedded formalin-fixed spheroids after which 5 μm sections from the blocks were examined by immunostaining. Paraffin sections were subjected to antigen retrieval for 30 minutes at 95˚C, deparaffinized in xylene, and rehydrated in a series of graded methanol. The slides were subsequently stained as described for adherent MKN-45 cells for STAT3. Additional slides were stained in a standard manner with hematoxylin and eosin (H&E).
Western blot analysis
Protein extracts were obtained from 106cells by lysis in Trizol (Qiagen, USA) that contained protease inhibitors (Sigma, USA). Cell lysates (20 μg) were separated on 10% sodium dodecyl sulfate (SDS)-polyacrylamide gel and then transferred to Polyvinylidene fluoride (PVDF) membranes (Bio-Rad, USA). The blots were blocked with 5% BSA in Tris buffered saline with tween (TBST, 20 mM Tris–HCl, pH=7.6, 150 mM NaCl, and 0.1% Tween-20), and then incubated overnight at 4˚C with polyclonal rabbit anti-STAT3 primary antibody (1:2000, Santa Cruz, USA) and 1 hour at room temperature for GAPDH (Sigma, USA). After washing with TBST, the membranes were incubated with anti-rabbit horseradish peroxidase (HRP)-conjugated secondary antibody (Sigma, USA) for 45 minutes at room temperature. Protein bands were visualized with ECL substrate (GE) on Hyperfilm (GE). GAPDH was used as the control for normalization.
Statistical analysis
Data were expressed as mean ± SD/SEM of at least three independent replicates. Statistical comparisons between two groups were made using one-way ANOVA, the student’s t test or nonparametric Mann-Whitney U test. P<0.05 was considered statistically significant.
Results
Gastrospheroids characterized as gastric cancer stem-like cells
The capability to form spheroid structures, a characteristic of embryonic stem cells, was used to enrich the cells with stemness properties within the cancer cells. MKN-45 single cells and tumor tissue fragments in defined serum free medium (SFM) supplemented with EGF, bFGF and B27 formed bodies that resembled spheres which were loosely attached cells that had a grape-like shape (Fig .1A-C). The spheroids were continuously passaged to form subspheroids. Spheres at passages 3 to 5 were used for further analyses. As shown in figure 1D, the rate of spheroid formation increased with increasing passage number (P<0.05). In the MKN-45 cell line this rate was 2.30% in MKN45 parental cells and increased to 18.03% in passage-2 MKN-45 spheroids. Also, passage-3 spheroids derived from GC 19 and GC 24 patient specimens were more potent in spheroid formation than the monolayer culture (Fig .1E).
We tested the drug resistance potential of GCSLCs and the parental cells by adding 0.5 μM of DTX (Fig .2A,B) to the single cells derived from spheroids or the monolayer culture of MKN-45 for 72 hours. Spheroid cells were significantly resistant to the cytotoxic effect of DTX (P<0.05) compared to MKN-45 parental cells.
We have evaluated whether spheroids overexpressed stems cell markers and EMT related genes that represented higher invasive capacity by qRTPCR. NANOG, OCT4, SOX2, c-MYC and KLF4 are engaged in the regulation of embryonic stem cell pluripotency and their involvement in maintenance of stemness features of different types of CSCs has recently been discovered. Our results determined that NANOG, c-MYC and SOX2 significantly up regulated (P<0.05) in spheroid derived cells from MKN-45 compared to parental cells. Spheroids of GC 19 and GC 24 patient samples also had increased NANOG expression (Fig .3A,B). The expressions of EMT regulatory markers CDH2, SNAIL2, TWIST and VIMENTIN were increased in MKN-45 gastrospheres (Fig .3C,P<0.05). However, the expression of CDH1, an epithelial marker, did not change in spheroid derived cells.


Examination of stem cell markers and EMT-related mRNA expression by qRT-PCR. A. Spheroids derived from MKN-45, B. Patientspecimens over expressed a number of stemness transcription factor genes compared to parental cells and C. mRNA levels of CDH2,SNAIL2, TWIST and VIMENTIN genes contributed to the EMT process were up regulated in MKN-45 spheroids compared to parentalcells. Data are mean ± SEM. *; P<0.05, EMT; Epithelial mesenchymal transition, GC; Gastric cancer and qRT-PCR; Quantitative real-timepolymerase chain reaction.

Gastric cancer stem-like cells had an enhancedlevel of STAT3 activation
In order to determine the presence of STAT3 activation, as an important signaling pathway in CSC self-renewal, we performed qRT–PCR, Western blot, immunostaining and flow cytometric analyses. As shown in figure 4A, STAT3 at the protein level expressed in both spheroids and MKN-45 monolayers. However, its mRNA level was more than two-fold higher in MKN-45 spheroids compared to parental cells (Fig .4B). Localization of STAT3 is dependent on its activation status. STAT3 localize in the cytoplasm, whereas its active form, p-STAT3, translocates to the nucleus. Immunostaining for STAT3 indicated that STAT3 was localized within the nucleus in spheroids. However in MKN-45 monolayers, STAT3 had a more intense cytoplasmic location compared to the nucleus (Fig .4C). Phosphoflowcytometry of p-STAT3 was performed to evaluate the activation status of the STAT3 transcription factor. The spheroid group of MKN-45 cell was 63% positive for p-STAT3 which was significantly (P<0.05) higher than the parental control group, which was 12% (Fig .4D,E). Analysis of spheroids derived from specimens GC 19 and GC 24 showed that 42% of GC 19 and 35% of GC 24 were p-STAT3 positive, while only 5 and 1% were respectively located in the monolayer culture of the related tissue (Fig .5).


Discussion
The link between infection, chronic inflammation, and cancer has long been recognized (29). Approximately 25% of cancers emerge due to chronic infection or other types of chronic inflammation (30). Helicobacter pylori (H.pylori) induced inflammation, as an example, is a major cause of GC (31). It is currently accepted that all solid tumors contain an inflammatory microenvironment (32). H.pylori, classified as a class I carcinogen (33), induces local chronic inflammation and persistent activation of multiple oncogenic signaling within the gastric epithelium (34). The proinflammatory microenvironment may deregulate stem/progenitor cell proliferation and differentiation (4), finally resulting in transformation of stem or progenitor cells to cancer stem cells (35). However, a number of reports have stated that GC may originate from bone marrow derived stem cells (BMDSCs) that migrate to inflammatory sites in the stomach (36). In attention to rigorous relationship between GC and inflammation and the role of STAT3 in inflammation, we have aimed to determine the status of STAT3 in the initiation of GC by conducting an evaluation of its activation in GCSLCs.
Contradictory reports on specification of CSCs and no consensus to define the best cell surface markers for GCSCs have encouraged us to enrich these cells according to a more definite functional assay-spheroid formation. Accumulating evidence suggests that spheroid structures derived from various cancers and cell lines known to be enriched with CSLCs as in GC (23,37,38). Our data supported the results from other reports which strongly suggested that spheroid structures could be indicators of putative cancer stem cells in the human GC cell line MKN-45 and GC tissue samples. The characteristics of spheroid cells were investigated with respect to spheroid-forming capacity, chemoresistancy to DTX, expression of pluripotency, and EMT markers. Compared with parental cells, the spheroid derived cells were more chemoresistant. DTX is administered to advanced GC patients either as a single agent or in combination with other chemotherapeutic agents. However, the response rates rarely exceed 40-45% (39). This decreased responsiveness or disease progression may be due to the presence of cells that have stemness features.
Contradictory reports on specification of CSCsand no consensus to define the best cell surfacemarkers for GCSCs have encouraged us to enrichthese cells according to a more definite functionalassay-spheroid formation. Accumulating evidencesuggests that spheroid structures derived from variouscancers and cell lines known to be enrichedwith CSLCs as in GC (23, 37, 38). Our data supportedthe results from other reports which stronglysuggested that spheroid structures could be indicatorsof putative cancer stem cells in the humanGC cell line MKN-45 and GC tissue samples. Thecharacteristics of spheroid cells were investigatedwith respect to spheroid-forming capacity, chemoresistancyto DTX, expression of pluripotency,and EMT markers. Compared with parental cells,the spheroid derived cells were more chemoresistant.DTX is administered to advanced GC patientseither as a single agent or in combination with otherchemotherapeutic agents. However, the responserates rarely exceed 40-45% (39). This decreasedresponsiveness or disease progression may be dueto the presence of cells that have stemness features.Chemotherapy accompanied by approaches thattarget these cells would be promising approaches.In a study by Liu et al. (37), gastrospheres of MKN-45 also exhibited resistance to 5-fluorouracil (5-FU) and DDP (cisplatin). They also overexpressedOCT-4, SOX2, NANOG and CD44.
We have found that GCSLCs had more similarcharacteristics to embryonic stem cells (ESCs)in the elevated expressions of some pluripotencyfactors SOX-2, NANOG and c-MYC. It has beenpreviously shown that the JAK/STAT3 pathway isimportant in the pluripotent state of murine ESCs(mESCs), mainly through activation of c-MYC andKLF4 (40). SOX2 in concert with OCT4 binds topromoters STAT3 and NANOG (41). According tothe present findings, the elevated level of SOX2in GCSCs could be one of the underlying mechanismsfor STAT3 gene overexpression. Previousstudy has also shown that NANOG functions inparallel to STAT3 in the maintenance of stem cellproperties (42). Bourguignon et al. (43) uncovereda functional link between NANOG and STAT3.These researchers reported that hyaluronan (HA)binding to CD44 induced NANOG activation and its interaction with STAT3 which resulted inSTAT3 specific transcriptional activation, MDR1gene expression, and tumor cell growth in humanbreast and ovarian tumor cells. They reported thatHA/CD44 signaling through NANOG/STAT3 promotedMIR-21 expression and further resulted inanti-apoptosis as well as chemoresistance in headand neck squamous cell carcinoma (HNSCC)cells (40). Of note, the miR-21 promoter containsSTAT3 binding site(s). A number of miRs are differentiallyexpressed in GCSCs and cancer cells.These include miR-21 and let-7a (44). STAT3controls expression of some miRs and identifiedputative STAT3 binding sites in promoter regionsof miRs, including miR-21 (45, 46). Hence, evaluationof the CD44/NANOG/STAT3 axis in regulationof specific miRs that control self-renewal inGCSCs seems to be valuable.
We illustrated here, the higher activation ofSTAT3 in GCSLCs by conducting an examinationof p-STAT3 and its nuclear location. Concomitantwith STAT3 overactivation, as a proinflammatorytranscription factor, we have observed upregulationof some EMT markers (CDH2, SNAIL2, TWISTand VIMENTIN) which are representative of themesenchymal phenotype and associated with invasion.There was no change in E-cadherin expressionlevel, which indirectly depends on STAT3 (47,48). STAT3 binds to and significantly activates theTWIST promoter in cooperation with EGF receptor(EGFR) in human breast cancer cells (49).
In agreement with the findings by Yang et al. (50)our results provided evidence that GCSCs mightbe involved in GC invasion and metastasis throughEMT. A crucial role for STAT3 in the EMT processcomes from the fact that EMT-related transcriptionfactors such as ZEB, TWIST and SNAIL are activatedby STAT3. Subsequently these transcriptionfactors down-regulate E-cadherin expression(47, 48). Other mechanisms proposed for STAT3mediated regulation of invasion include control ofWASF3 protein activation (51) or through inductionor suppression of effector miRs expression.MiR-34a is directly repressed by STAT3 and it hasbeen demonstrated that in colorectal cancer an activeIL-6R/STAT3/miR-34a loop is necessary forEMT, invasion and metastasis (52).
Thus, our recent experiments in accordance withprevious evidences have shown the potential rolesof the STAT3 signaling pathway in developmentof chemoresistance or regulation of EMT in GCSCs.Based on the investigation on glioblastomaand breast cancers, STAT3 overactivation has beenrecognized to be essential for proliferation, sphereformation, EMT and tumorigenesis of CSCs (16,17, 53, 54).
Conclusion
Spheroid formation provides an applicablemethod to isolate GCSLCs from the MKN-45 cellline and probably from tissue samples. We havefound that gastrospheroids resembeled as GCSLCs,express STAT3 that is phosphorylated on theactivating tyrosine (Tyr 705) and has an intranuclearlocalization. It is necessary to discover thedefinitive markers that identify GCSCs. Furtherconfirmation that aberrant activation of STAT3is effective in stemness and invasion of GCSLCsthrough STAT3 inhibition and the definite mechanismof action of GCSCs through examination ofmore tissue samples and additional in vivo experiments.
Acknowledgments
This work was financially supported by TarbiatModares University and Royan Institute for StemCell Biology and Technology Council for Stem CellResearch and Technology. The authors declared noconflict of interests.
References
- 1. Cancer research.Mutant stem cells may seed cancerScience2003301563813081310[PubMed][Google Scholar]
- 2. Identification of human brain tumour initiating cellsNature20044327015396401[PubMed][Google Scholar]
- 3. Signal transduction and the control of gene expressionScience20022955556813818[PubMed][Google Scholar]
- 4. The cancer stem cell niche--there goes the neighborhood?Int J Cancer20111291023152327[PubMed][Google Scholar]
- 5. STATs in cancer inflammation and immunity: a leading role for STAT3Nat Rev Cancer2009911798809[PubMed][Google Scholar]
- 6. STAT signaling in cancer: insights into pathogenesis and treatment strategiesCancer Treat Res2003115267291[PubMed][Google Scholar]
- 7. Constitutive activation of Stat3 by the Src and JAK tyrosine kinases participates in growth regulation of human breast carcinoma cellsOncogene2001202024992513[PubMed][Google Scholar]
- 8. The role of STATs in myeloid differentiation and leukemiaOncogene2000192125112522[PubMed][Google Scholar]
- 9. Activated signal transducer and activator of transcription 3 (STAT3) supports the malignant phenotype of human pancreatic cancerGastroenterology20031253891905[PubMed][Google Scholar]
- 10. Constitutive activation of stat 3 oncogene product in human ovarian carcinoma cellsGynecol Oncol20007916773[PubMed][Google Scholar]
- 11. Selective activation of members of the signal transducers and activators of transcription family in prostate carcinomaJ Urol2002167418591862[PubMed][Google Scholar]
- 12. STAT3 is constitutively activated and supports cell survival in association with survivin expression in gastric cancer cellsOncogene2004232849214929[PubMed][Google Scholar]
- 13. STAT3 expression in gastric cancer indicates a poor prognosisJ Gastroenterol Hepatol2009244646651[PubMed][Google Scholar]
- 14. Essential role of STAT3 for embryonic stem cell pluripotencyProc Natl Acad Sci USA199996628462851[PubMed][Google Scholar]
- 15. Novel STAT3 target genes exert distinct roles in the inhibition of mesoderm and endoderm differentiation in cooperation with NanogStem Cells200927817601771[PubMed][Google Scholar]
- 16. The JAK2/STAT3 signaling pathway is required for growth of CD44+CD24stem cell-like breast cancer cells in human tumorsJ Clin Invest2011121727232735[PubMed][Google Scholar]
- 17. STAT3 is required for proliferation and maintenance of multipotency in glioblastoma stem cellsStem Cells2009271023832392[PubMed][Google Scholar]
- 18. Inflammation and EMT: an alliance towards organ fibrosis and cancer progressionEMBO Mol Med200916-7303314[PubMed][Google Scholar]
- 19. The involvement of JAKSTAT3 in cell motility, invasion, and metastasisJAKSTAT201431e28086e28086[PubMed][Google Scholar]
- 20. Cancer metastasis: building a frameworkCell20061274679695[PubMed][Google Scholar]
- 21. Cancer stem cells and epithelialmesenchymal transition: concepts and molecular linksSemin Cancer Biol2012225-6396403[PubMed][Google Scholar]
- 22. Identification of gastric cancer stem cells using the cell surface marker CD44Stem Cells200927510061020[PubMed][Google Scholar]
- 23. Cancer spheres from gastric cancer patients provide an ideal model system for cancer stem cell researchCell Mol Life Sci2011682135893605[PubMed][Google Scholar]
- 24. Identification and expansion of cancer stem cells in tumor tissues and peripheral blood derived from gastric adenocarcinoma patientsCell Res2012221248258[PubMed][Google Scholar]
- 25. Expression of cancer stem cell markers ALDH1, CD44 and CD133 in primary tumor and lymph node metastasis of gastric cancerPathol Int2012622112119[PubMed][Google Scholar]
- 26. Expressions of putative cancer stem cell markers ABCB1, ABCG2, and CD133 are correlated with the degree of differentiation of gastric cancerGastric Cancer2012154440450[PubMed][Google Scholar]
- 27. Cancer stem cell-like SP cells have a high adhesion ability to the peritoneum in gastric carcinomaCancer Sci2009100813971402[PubMed][Google Scholar]
- 28. Tumor initiating potential of side population cells in human gastric cancerInt J Oncol200934512017[PubMed][Google Scholar]
- 29. Inflammation and cancer: back to virchow?Lancet20013579255539545[PubMed][Google Scholar]
- 30. Inflammation and cancer: an ancient link with novel potentialsInt J Cancer20071211123732380[PubMed][Google Scholar]
- 31. Progression of chronic atrophic gastritis associated with Helicobacter pylori infection increases risk of gastric cancerInt J Cancer20041091138143[PubMed][Google Scholar]
- 32. The gastrointestinal tumor microenvironmentGastroenterology201314516378[PubMed][Google Scholar]
- 33. Schistosomes, liver flukes and Helicobacter pyloriIARC Working Group on the Evaluation of Carcinogenic Risks to Humans.Lyon, 7-14 June 1994IARC Monogr Eval Carcinog Risks Hum1994611241[PubMed][Google Scholar]
- 34. Helicobacter pylori infection, oncogenic pathways and epigenetic mechanisms in gastric carcinogenesisFuture Oncol201065851862[PubMed][Google Scholar]
- 35. The gastrointestinal tract stem cell nicheStem Cell Rev200623203212[PubMed][Google Scholar]
- 36. Gastric cancer originating from bone marrowderived cellsScience2004306570115681571[PubMed][Google Scholar]
- 37. Spheroid body-forming cells in the human gastric cancer cell line MKN-45 possess cancer stem cell propertiesInt J Oncol2013422453459[PubMed][Google Scholar]
- 38. Significantly increased expression of OCT4 and ABCG2 in spheroid body-forming cells of the human gastric cancer MKN-45 cell lineOncol Lett201364891896[PubMed][Google Scholar]
- 39. Review of docetaxel in the treatment of gastric cancerTher Clin Risk Manag2008459991007[PubMed][Google Scholar]
- 40. Stem cell marker (Nanog) and Stat-3 signaling promote MicroRNA-21 expression and chemoresistance in hyaluronan/ CD44-activated head and neck squamous cell carcinoma cellsOncogene2012312149160[PubMed][Google Scholar]
- 41. Core transcriptional regulatory circuitry in human embryonic stem cellsCell20051226947956[PubMed][Google Scholar]
- 42. Maintenance of pluripotency in human and mouse embryonic stem cells through activation of Wnt signaling by a pharmacological GSK-3-specific inhibitorNat Med20041015563[PubMed][Google Scholar]
- 43. HyaluronanCD44 interaction activates stem cell marker Nanog, Stat3-mediated MDR1 gene expression, and ankyrin-regulated multidrug efflux in breast and ovarian tumor cellsJ Biol Chem2008283251763517651[PubMed][Google Scholar]
- 44. miRNAs expressed differently in cancer stem cells and cancer cells of human gastric cancer cell line MKN-45Cell Biochem Funct2012305411418[PubMed][Google Scholar]
- 45. STAT3 regulation of and by microRNAs in development and diseaseJAKSTAT201213143150[PubMed][Google Scholar]
- 46. Signal transducer and activator of transcription (STAT)-3 regulates microRNA gene expression in chronic lymphocytic leukemia cellsMol Cancer2013125050[PubMed][Google Scholar]
- 47. Roles of STAT3 and ZEB1 proteins in E-cadherin downregulation and human colorectal cancer epithelial-mesenchymal transitionJ Biol Chem2012287858195832[PubMed][Google Scholar]
- 48. Normal and disease-related biological functions of Twist1 and underlying molecular mechanismsCell Res201222190106[PubMed][Google Scholar]
- 49. Epidermal growth factor receptor cooperates with signal transducer and activator of transcription 3 to induce epithelial-mesenchymal transition in cancer cells via upregulation of TWIST gene expressionCancer Res2007671990669076[PubMed][Google Scholar]
- 50. Gastric cancer stem-like cells possess higher capability of invasion and metastasis in association with a mesenchymal transition phenotypeCancer Lett201131014652[PubMed][Google Scholar]
- 51. Critical role of the WASF3 gene in JAK2/STAT3 regulation of cancer cell motilityCarcinogenesis201334919941999[PubMed][Google Scholar]
- 52. IL-6R/STAT3/miR-34a feedback loop promotes EMT-mediated colorectal cancer invasion and metastasisJ Clin Invest2015125313621362[PubMed][Google Scholar]
- 53. STAT3 activation in HER2-overexpressing breast cancer promotes epithelialmesenchymal transition and cancer stem cell traitsInt J Oncol2014442403411[PubMed][Google Scholar]
- 54. STAT3 is essential for the maintenance of neurosphere-initiating tumor cells in patients with glioblastomas: a potential for targeted therapy?Int J Cancer20111284826838[PubMed][Google Scholar]