Heshouwu (Polygonum multiflorum Thunb.) Extract Attenuates Bone Loss in Diabetic Mice
Abstract
This study investigated the effects and mechanism of Heshouwu (Polygonum multiflorum Thunb.) water extract (HSW) on diabetes-related bone loss in mice. HSW was orally administered (300 mg/kg body weight) to high-fat diet and streptozotocin-induced diabetic mice for 10 weeks. HSW significantly alleviated mouse body weight loss and hyperglycemia compared with the control group, and elevated serum levels of insulin, osteocalcin, and bone-alkaline phosphatase. HSW supplementation also significantly increased the bone volume/tissue volume ratio and trabecular thickness and number, and decreased the bone surface/bone volume ratio and trabecular structure model index in the femur and tibia. Moreover, HSW significantly increased femoral bone mineral density. In addition, HSW down-regulated osteoclastogenic genes, such as nuclear factor of activated T-cells, cytoplasmic 1 and tartrate-resistant acid phosphatase 5 (TRAP), in both the femur and tibia tissue, and reduced serum TRAP level compare to those of control mice. These results indicate that HSW might relieve diabetes-related bone disorders through regulating osteoclast-related genes, suggesting HSW may be used as a preventive agent for diabetes-induced bone loss.
INTRODUCTION
Diabetes mellitus (DM) is a common progressive metabolic disease that may lead to complications such as retinopathy, neuropathy, nephropathy, cardiovascular disease, and osteoporosis. Diabetic complications are major public health problems and are increasing in prevalence worldwide (Abdulameer et al., 2012). Fragility fractures have increasingly been recognized as a complication of both type 1 and 2 diabetes mellites (T1DM and T2DM, respectively) (Ferrari et al., 2018), and are the leading cause of morbidity and mortality in older adults with diabetes (Cauley, 2013). Low bone mineral density (BMD) is a risk factor of fragility fractures; BMD has been shown to decrease in T1DM, and to both decrease and increase in T2DM as compared healthy individuals (Napoli et al., 2017; Raška et al., 2017). Moreover, anti-diabetic medications, such as thiazolidinediones and sodium glucose cotransporter 2 inhibitors, have been shown to induce diabetic bone disorders via effects on bone and mineral metabolism (Palermo et al., 2015; Meier et al., 2016; Gilbert and Pratley, 2015). Recently, natural plants have attracted a great deal of interest as sources of alternative medicines for prevention and treatment of diabetes-related bone disorders.
Polygonum multiflorum Thunb. is a popular Chinese traditional medicinal herb, which is known as Heshouwu in China, Korea, and East Asia, and as Fo-ti in North America (Bounda and Feng, 2015). Heshouwu has a low toxicity and exhibits various pharmacological activities, such as anti-tumor (Horikawa et al., 1994; Choi et al., 2007), anti-inflammation (Cha and Jeon, 2009), nephroprotective (Guo et al., 2001), anti-atherosclerosis (Yang et al., 2005; Zhang et al., 2007), and anti-diabetes (Kang et al., 2005) activities. We previously showed that Heshouwu ethanol extract attenuates hyperglycemia and hyperinsulinemia in diet-induced obese mice (Choi et al., 2018). Hwang et al. (2016) and Kim et al. (2018b) reported that Heshouwu hot water extract and tetrahydroxystilbene glucoside (THSG), which is a bioactive compound of Heshouwu, prevent bone loss in estrogen deficient mice. Zhang et al. (2019) recently reported that THSG protects against diabetes-induced osteoporosis in mice with streptozotocin (STZ)-induced diabetes. However, it remains unknown if Heshouwu can regulate diabetes-induced bone loss in vivo, or the mechanism by which its effects occur. Therefore, we investigated the effects of Heshouwu water extract (HSW) on serum bone-related markers, BMD, bone quality parameters and bone metabolism-related gene levels in high-fat diet (HFD) and STZ-induced diabetic mice.
MATERIALS AND METHODS
Heshouwu (Polygonum multiflorum Thunb.) extract
Heshouwu (500 g) (Dong-Bu Herbal Makers, Suncheon, Korea) were extracted three times with water (each 5 L) by exhaustive maceration under sonication at 85°C for 3 h. The supernatant was filtered using Whatman number 2 filter paper (Whatman, Kent, England). The extracted fluid was concentrated with a rotary evaporator (EYELA, Tokyo, Japan) and freeze-dried to yield crude extract (25.2%).
Animal experiment
Male four-week-old C57BL/6N mice were purchased from Orient Bio Inc. (Seongnam, Korea). The animals were individually housed in polycarbonate cages and maintained in a temperature and humidity-controlled room (22±2 °C, 50±5% humidity) under a 12-h light-dark cycle. This study was approved by the Institutional Animal Care and Use Committee of Sunchon National University (approval number, SCNU IACUC-2016-11). All mice were acclimatized for 7 days, then fed HFD (40% calories from fat) for 4 weeks. After the HFD feeding period, mice were intraperitoneally injected with STZ (100 mg/kg body weight) dissolved in 0.1 M citrate buffer at pH 4.2 for 2 consecutive days. Only mice that exhibited a fasting blood glucose (FBG) level ≥ 250 mg/dL after 7 days were used in the study. The diabetic mice were randomly divided into two groups of eight mice each (control and HSW-treated group). In the present study, HSW was orally administered at 300 mg/kg body weight for 10 weeks, as described previously (Do et al., 2011).
During the experimental period, blood glucose levels and body weight were measured weekly and food consumption was measured daily. At the end of the experimental period, mice were anesthetized with ether and sacrificed after 12 h of fasting to collect blood and tissue samples for analysis. Blood samples were collected from the inferior vena cava and centrifuged (3,000 rpm for 15 min at 4°C) to separate out the serum. Tissues (liver, kidney, heart, and bone) were removed, rinsed with an ice-cold physiological saline solution, and weighed.
Micro-computed tomography (μCT) analysis
For μCT analysis of bone tissues (femurs and tibias), samples were isolated, cleaned of adherent soft tissues, and kept in 70% ethyl alcohol solution until scanning. To prevent moisture infiltrating, samples were wrapped with plastic wrap and placed into a holder. Morphometric parameters of bone samples were assessed using a μCT system (Skyscan 1272, Bruker, Kontich, Belgium). The scan setting were as follows: voltage of 70 kV, current of 142 μA, resolution step of 26.5 μm, and rotation step of 0.4°. 2D images were obtained for visualization and display. The image slices were reconstructed and analyzed using NReacon and CTAn (version 1.16.4.1, Bruker) software. BMD, bone volume/tissue volume ratio (BV/TV), bone surface/bone volume ratio (BS/BV), trabecular number (Tb.N), trabecular thickness (Tb.Th), trabecular separation (Tb.Sp), and structure model index (SMI) were then calculated. For quantification of trabecular BMD, the μCT was calibrated using two standard phantoms with a density of 0.25 and 0.75 g/cm3. The distal femur and tibia metaphysic represented regions of interest for analysis.
Blood glucose, glycosylated hemoglobin (HbA1c), serum insulin, and bone markers
The FBG concentration was monitored using a glucometer (G-doctor, AllMedicus Co., Ltd., Anyang, Korea). Venous blood was drawn from the tail vein every week after a six-hour fast, and the HbA1c concentration in whole blood was measured using a NycoCard Reader II (Alere/Axis-Shield, Oslo, Norway). Serum insulin (Morinaga Institute of Biological Science, Yokohama, Japan), osteocalcin (OCN, Elabscience, Wuhan, China), bone-alkaline phosphatase (BAP, Elabscience), and tartrate-resistant acid phosphatase 5 (TRAP) (Cusabio Biotech, Wuhan, China) levels were determined using mouse enzyme-linked immunosorbent assay kits.
Quantitative polymerase chain reaction analysis
Total RNA isolation from bone tissue and mRNA expression (NFATc1: nuclear factor of activated T-cells, cytoplasmic 1, RANKL: receptor activator of nuclear factor kappa-B ligand, and TRAP) analysis were conducted as previously described (Ham et al., 2017). The sequences of the primers used are shown in Table 1. Gene expression was normalized against the β-actin gene.
Statistical analysis
All data are expressed as the mean±standard error (SE). The SPSS program was used to conduct all statistical analyses (SPSS Inc., Chicago, IL, USA). Data between groups were compared by Student’s t-test. Correlations between serum insulin levels and BMD were assessed by Pearson’s correlation analysis. A P<0.05 was considered statistically significant for all analyses.
RESULTS AND DISCUSSION
Effects of HSW on blood glucose, HbA1c, and insulin level
This study showed that HSW suppressed increases in FBG levels throughout the experimental period in HFD and STZ induced-diabetic mice; FBG levels were significantly lower (21%) in HSW mice compared with control mice at week 10 (Fig. 1A). THSG extracted from HSW has been shown to have hypoglycemic effects and to protect against nephropathy in mice and rats (Li et al., 2010; Chen et al., 2016; Zhang et al., 2012). HbA1c levels reflect average blood glucose levels over the past 2~3 months (Khan and Weinstock, 2011); we therefore measured HbA1c levels in the present study. Although not statistically significant, HSW-administered mice showed a decrease in HbA1c levels approximately 10.4% (Fig. 1B). Since long-term hyperglycemia decreases body weight and insulin levels, we measured the effects of HSW on these parameters. The results demonstrated that HSW prevented body weight loss and increased serum insulin levels (Fig. 1C, D, and Table 2); however, HSW did not affect the weight of organs (liver, kidney and heart) or food intake (Table 2). Thus, these results indicate that HSW might exert anti-diabetic effects by increasing insulin levels.
Effects of HSW on microarchitecture and serum markers of bone conversion
Diabetic patients have a higher risk of bone fractures (Kanazawa, 2015). Because our coworkers previously indicated that HSW hot water extract and its bioactive component THSG prevent bone loss in an ovariectomy-induced osteoporosis mouse model (Hwang et al., 2016; Kim et al., 2018b), this study was conducted to determine if HSW extract may prevent bone loss caused by diabetes.
Osteoporosis is characterized by low bone mass and microstructural damage of the bone tissue (Li et al., 2019). Two dimensional μCT images of femoral and tibial trabecular and cortical bones revealed greater bone densities in the HSW group than the control group (Fig. 2A). BMD is the major quantitative indicator of osteoporosis (Li et al., 2019). In the present study, HSW significantly increased femoral BMD by 1.8-fold and tended to increase the tibial BMD by 1.3-fold compared to the control group (Fig. 2B). Interestingly, we found that serum insulin levels were positively associated with the BMD in the femur (r=0.690, P<0.001) and tibia (r=0.569, P<0.05), respectively (Fig. 2C). Compared with the control group, HSW significantly increased the BV/TV, Tb.Th, and Tb.N, and decreased the BS/BV and SMI (Fig. 3). In addition, HSW significantly decreased Tb.Sp in the femur (Fig. 3). Diabetes induces trabecular microarchitecture deterioration resulting in thinner and more rod-like trabeculae (higher SMI), which are more prone to bending deformation (Acevedo et al., 2018). Here, we found that HSW induced thicker, more plate-like trabeculae, and increased their numbers, indicating that bone strength was increased relative to the control group. These results suggest that HSW might increase bone mass and alleviate the trabecular microstructure in diabetic mice, while increasing insulin levels.
To confirm the anti-osteoporosis effects of HSW, we evaluated serum bone-related biochemical indexes. Compared with the control group, in the HSW group serum OCN and BAP were increased, and TRAP was decreased (Table 3). OCN plays a key role in mineralization and may be essential for osteoblast differentiation (Hienz et al., 2015). Kanazawa (2015) reported that OCN directly stimulates insulin secretion in the pancreas, which may be an important factor linking bone and glucose homeostasis. BAP is also an important marker of bone formation and bone turnover, and is used in the evaluation of skeletal status (Lim et al., 2016). In contrast, the increased TRAP in diabetic rats reflects a trend toward bone loss (Rivoira et al., 2018; Liu et al., 2018). Thus, HSW increases the bone formation markers OCN and BAP, and suppresses the bone resorption marker TRAP in diabetic mice.
Effects of HSW on bone metabolism-related gene expression
We investigated the effect of HSW on bone formation and resorption-related gene expression. The results revealed that HSW significantly down-regulated osteoclastogenic genes, such as NFATc1 and TRAP, in both the femur and tibia compared to the control group (Fig. 4). Bone remodeling is regulated by the balance between bone formation (osteoblasts) and bone resorption (osteoclasts) (Teitelbaum, 2000). Loss of this homeostasis leads to bone diseases such as osteoporosis, rheumatoid arthritis, and osteosarcoma. Osteoclasts are bone resorbing cells that are differentiated from the hematopoietic stem cells monocyte/macrophage lineage by RANKL (Kim et al., 2018a). In the present study, HSW decreased RANKL mRNA levels in the femur (52.8%) and tibia (31.2%) compared controls, although this decrease was only significant in the femur (Fig. 4). Binding of RANKL to its receptor on the surface of osteoclast precursor cells induces expression of important transcription factors for osteoclastogenesis, such as nuclear factor-κB, c-Fos, and NFATc1 (Kim and Kim, 2014). In particular, NFATc1 is an indispensable factor for osteoclast differentiation in vitro and in vivo, which suggests that its regulation could be targeted by novel therapeutic strategies for bone diseases (Kim and Kim, 2014). NFATc1 controls osteoclast-specific genes, such as TRAP, cathepsin K, and calcitonin receptor (Kim et al., 2018a). NFATc1 expression in the femur (r=0.546, P<0.05) and tibia (r=0.622, P<0.05) were negatively correlated with serum BAP levels (data not shown). In the present study, HSW suppressed NFATc1 expression in the femur and tibia and downstream TRAP expression, which corresponded to reduced serum TRAP levels relative to the control. Reducing osteoclast differentiation-associated pathways by HSW may therefore represent a potential method for therapeutic intervention to prevent diabetes-related bone loss. In contrast, a previous study showed that THSG increases osteoblastogenic genes such as runt-related transcription factor 2 (RUNX-2), OCN, and ALP in STZ-induced diabetic mice (Zhang et al., 2019). Our data did not show significant changes in RUNX-2, OCN, and ALP between groups (data not shown). In conclusion, these results indicate that HSW might play a protective role in diabetesinduced osteoporosis, in part by down-regulating osteoclastogenesis.
Genes | Primer sequences (5′ → 3′) | Size (bp) | |
---|---|---|---|
NFATc1 | Forward | AGGACCCGGAGTTCGACTT | 106 |
Reverse | GTCGAGGTGACACTAGGGGA | ||
RANKL | Forward | CGAGGAAGGGAGAGAACGAT | 92 |
Reverse | AGGTACTTGCCGTAGTCTCG | ||
TRAP | Forward | AGGAAGAGCCTTCAAGTAAGTG | 89 |
Reverse | CCACCCATGAATCCATCTTCT | ||
β-Actin | Forward | GATCAGCAAGCAGGAGTACGA | 91 |
Reverse | GGTGTAAAACGCAGCTCAGTAAC |
NFATc1, nuclear factor of activated T-cells, cytoplasmic 1; RANKL, receptor activator of nuclear factor kappa-B ligand; TRAP, tartrate-resistant acid phosphatase 5.
Control | HSW | |
---|---|---|
Body weight gain (g) | −2.35±0.59 | −0.25±0.74* |
Food intake (g/d) | 3.80±0.08 | 3.54±0.14 |
Liver | 51.89±2.16 | 45.85±1.22 |
Kidney | 16.52±0.59 | 15.10±1.90 |
Heart | 4.92±0.11 | 4.66±0.23 |
Values are significantly different between groups according to Student’s t-test.
*P<0.05 versus control.
Control | HSW | |
---|---|---|
OCN | 0.87±0.14 | 4.85±0.60** |
BAP | 0.90±0.27 | 2.27±0.39* |
TRAP | 61.27±2.33 | 49.79±1.14** |
Values are significantly different between groups according to Student’s t-test.
*P<0.05 and
**P<0.01 versus control.
Footnotes
AUTHOR DISCLOSURE STATEMENT
The authors declare no conflict of interest.
ACKNOWLEDGEMENTS
This research was supported by Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education (No. NRF-2015R1C1A2A01052146) and Suncheon Research Center for Natural Medicines.
References
- 1. Osteoporosis and type 2 diabetes mellitus: what do we know, and what we can do?Patient Prefer Adherence20126435448[PubMed][Google Scholar]
- 2. Contributions of material properties and structure to increased bone fragility for a given bone mass in the UCD-T2DM rat model of type 2 diabetesJ Bone Miner Res20183310661075[PubMed][Google Scholar]
- 3. Review of clinical studies of Polygonum multiflorum Thunb. and its isolated bioactive compoundsPharmacognosy Res20157225236[PubMed][Google Scholar]
- 4. Public health impact of osteoporosisJ Gerontol A Biol Sci Med Sci20136812431251[PubMed][Google Scholar]
- 5. Anti-inflammatory effect of MeOH extracts of the stem of Polygonum multiflorum in LPS-stimulated mouse peritoneal macrophagesNat Prod Sci2009158389[Google Scholar]
- 6. 2,3,5,4′-Tetrahydroxystilbene-2-O-β-D-glucoside exerted protective effects on diabetic nephropathy in mice with hyperglycemia induced by streptozotocinFood Funct2016746284636[PubMed][Google Scholar]
- 7. Heshouwu (Polygonum multiflorum Thunb.) ethanol extract suppresses preadipocytes differentiation in 3T3-L1 cells and adiposity in obese miceBiomed Pharmacother2018106355362[PubMed][Google Scholar]
- 8. Anthraquinones, Cdc25B phosphatase inhibitors, isolated from the roots of Polygonum multiflorum ThunbNat Prod Res200721487493[PubMed][Google Scholar]
- 9. Antiosteoporotic effects of Polygoni Multiflori Radix (PMR) in ovariectomized (OVX)-induced osteoporosis ddY miceJ Vet Clin201128375386[Google Scholar]
- 10. Diagnosis and management of bone fragility in diabetes: an emerging challengeOsteoporos Int20182925852596[PubMed][Google Scholar]
- 11. The impact of diabetes and diabetes medications on bone healthEndocr Rev201536194213[PubMed][Google Scholar]
- 12. Rhein inhibits renal tubular epithelial cell hypertrophy and extracellular matrix accumulation induced by transforming growth factor beta1Acta Pharmacol Sin200122934938[PubMed][Google Scholar]
- 13. Methoxsalen supplementation attenuates bone loss and inflammatory response in ovariectomized miceChem Biol Interact2017278135140[PubMed][Google Scholar]
- 14. Mechanisms of bone resorption in periodontitisJ Immunol Res20152015615486[PubMed][Google Scholar]
- 15. Moderate inhibition of mutagenicity and carcinogenicity of benzo[a]pyrene, 1,6-dinitropyrene and 3,9-dinitrofluoranthene by Chinese medicinal herbsMutagenesis19949523526[PubMed][Google Scholar]
- 16. Effects of hot water extracts from Polygonum multiflorum on ovariectomy induced osteopenia in miceEvid Based Complement Alternat Med201620168970585[PubMed][Google Scholar]
- 17. Osteocalcin as a hormone regulating glucose metabolismWorld J Diabetes2015613451354[PubMed][Google Scholar]
- 18. The inhibitory activity of Polygonum multiflorum Thunberg and its effect on postprandial hyperglycemia in streptozotocin-induced diabetic ratsNutr Sci20058226230[Google Scholar]
- 19. CarbohydrateHenry’s Clinical Diagnosis and Management by Laboratory Methods22nd edSaunders ElsevierPhiladelphia, PA, USA2011210225[PubMed][Google Scholar]
- 20. Regulation of NFATc1 in osteoclast differentiationJ Bone Metab201421233241[PubMed][Google Scholar]
- 21. Betulin suppresses osteoclast formation via down-regulating NFATc1J Clin Med2018a7E154[PubMed][Google Scholar]
- 22. Protective effects of 2,3,5,4′-tetrahydroxystilbene-2-O-β-D-glucoside on ovariectomy induced osteoporosis mouse modelInt J Mol Sci2018b19E2554[PubMed][Google Scholar]
- 23. Tetrahydroxystilbene glucoside ameliorates diabetic nephropathy in rats: involvement of SIRT1 and TGF-β1 pathwayEur J Pharmacol2010649382389[PubMed][Google Scholar]
- 24. Oviductus Ranae protein hydrolyzate prevents menopausal osteoporosis by regulating TGFβ/BMP2 signalingArch Gynecol Obstet2019299873882[PubMed][Google Scholar]
- 25. Bone alkaline phosphatase as a surrogate marker of bone metastasis in gastric cancer patientsBMC Cancer201616385[PubMed][Google Scholar]
- 26. Aqueous extract of Mori Folium exerts bone protective effect through regulation of calcium and redox homeostasis via PTH/VDR/CaBP and AGEs/RAGE/Nox4/NF-κB signaling in diabetic ratsFront Pharmacol201891239[PubMed][Google Scholar]
- 27. Effects of diabetes drugs on the skeletonBone20168293100[PubMed][Google Scholar]
- 28. Mechanisms of diabetes mellitus-induced bone fragilityNat Rev Endocrinol201713208219[PubMed][Google Scholar]
- 29. Oral anti-diabetic drugs and fracture risk, cut to the bone: safe or dangerous? A narrative reviewOsteoporos Int20152620732089[PubMed][Google Scholar]
- 30. Body composition is associated with bone and glucose metabolism in postmenopausal women with type 2 diabetes mellitusPhysiol Res20176699111[PubMed][Google Scholar]
- 31. Naringin prevents bone loss in a rat model of type 1 diabetes mellitusArch Biochem Biophys20186375663[PubMed][Google Scholar]
- 32. Bone resorption by osteoclastsScience200028915041508[PubMed][Google Scholar]
- 33. Reduction of atherosclerosis in cholesterol-fed rabbits and decrease of expressions of intracellular adhesion molecule-1 and vascular endothelial growth factor in foam cells by a water-soluble fraction of Polygonum multiflorumJ Pharmacol Sci200599294300[PubMed][Google Scholar]
- 34. Inhibitory effects of 2,3,5,4′-tetrahydroxystilbene-2-O-β-D-glucoside on experimental inflammation and cyclooxygenase 2 activityJ Asian Nat Prod Res20079355363[PubMed][Google Scholar]
- 35. Tetrahydroxy stilbene glucoside protected against diabetes-induced osteoporosis in mice with streptozotocin-inducedPhytother Res201933442451[PubMed][Google Scholar]
- 36. 2,3, 4′,5-Tetrahydroxystilbene 2-O-β-D-glucoside prevents vascular endothelial dysfunction in a type 2 diabetic rat modelAfr J Pharm Pharmacol2012630673074[PubMed][Google Scholar]