Epithelial Cell Gene Expression Induced by Intracellular Staphylococcus aureus.
Journal: 2011/July - International Journal of Microbiology
ISSN: 1687-9198
Abstract:
HEp-2 cell monolayers were cocultured with intracellular Staphylococcus aureus, and changes in gene expression were profiled using DNA microarrays. Intracellular S. aureus affected genes involved in cellular stress responses, signal transduction, inflammation, apoptosis, fibrosis, and cholesterol biosynthesis. Transcription of stress response and signal transduction-related genes including atf3, sgk, map2k1, map2k3, arhb, and arhe was increased. In addition, elevated transcription of proinflammatory genes was observed for tnfa, il1b, il6, il8, cxcl1, ccl20, cox2, and pai1. Genes involved in proapoptosis and fibrosis were also affected at transcriptional level by intracellular S. aureus. Notably, intracellular S. aureus induced strong transcriptional down-regulation of several cholesterol biosynthesis genes. These results suggest that epithelial cells respond to intracellular S. aureus by inducing genes affecting immunity and in repairing damage caused by the organism, and are consistent with the possibility that the organism exploits an intracellular environment to subvert host immunity and promote colonization.
Relations:
Content
Citations
(6)
References
(73)
Affiliates
(1)
Similar articles
Articles by the same authors
Discussion board
International Journal of Microbiology. Dec/31/2008; 2009
Published online Feb/2/2009

Epithelial Cell Gene Expression Induced by Intracellular Staphylococcus aureus

Abstract

HEp-2 cell monolayers were cocultured with intracellular Staphylococcus aureus, and changes in gene expression were profiled using DNA microarrays. Intracellular S. aureus affected genes involved in cellular stress responses, signal transduction, inflammation, apoptosis, fibrosis, and cholesterol biosynthesis. Transcription of stress response and signal transduction-related genes including atf3, sgk, map2k1, map2k3, arhb, and arhe was increased. In addition, elevated transcription of proinflammatory genes was observed for tnfa, il1b, il6, il8, cxcl1, ccl20, cox2, and pai1. Genes involved in proapoptosis and fibrosis were also affected at transcriptional level by intracellular S. aureus. Notably, intracellular S. aureus induced strong transcriptional down-regulation of several cholesterol biosynthesis genes. These results suggest that epithelial cells respond to intracellular S. aureus by inducing genes affecting immunity and in repairing damage caused by the organism, and are consistent with the possibility that the organism exploits an intracellular environment to subvert host immunity and promote colonization.

1. Introduction

Staphylococcus aureus (S. aureus), a nosocomial or community-acquiredpathogen that colonizes much of the healthy population [1], is an important cause ofskin infections, pneumonia, septicemia, endocarditis, osteomyelitis,folliculitis, mastitis, and other infections. The organism also causestoxigenic illnesses such as food poisoning and toxic shock syndrome [2]. Infections caused by S. aureus may be refractory to therapy and become chronic or recur,despite acceptable therapy [36].

Several studiesshowed that S. aureus can becomeinternalized by nonprofessional phagocytes [79]; α5β1 integrin is necessary for fibronectin-mediated S. aureus internalizationinvolving staphylococcal fibronectin-binding proteins [10, 11]. Internalization may provide several benefits to S. aureus. It has been proposed thatintracellular S. aureus evadesexposure to antibiotics [3] and host immunity. It also provides an intracellularmilieu which leads to the formation of small-colony variants with decreasedmetabolic activity and increased antibiotic resistance [12].

Microarraytechnology has helped elucidate pathogen-host cell interactions and profile theeffects on epithelial cells by organisms including, but not limited to, Yersiniaenterocolitica [13], Salmonella dublin [14], Shigella flexneri [15], Bordetella pertussis [16], Mycobacterium tuberculosis [17], Pseudomonas aeruginosa [18], Listeria monocytogenes [19], Streptococcus pyogenes [20], and S. aureus [21, 22]. Although the internalization of S. aureus by nonprofessional phagocytesis well documented [5, 79, 2325], the cellular response tointracellular S. aureus has only beenpartially elucidated [3, 26], focusing mainly on apoptosis[2733]. The present study assessed global changes ingene expression over an 8-hour time period in epithelial cell monolayersinduced by intracellular S. aureus. The data demonstrated that culturedepithelial cells respond to intracellular S. aureus by inducing several classes of genes that could influence theoutcome of colonization or infection by this organism in vivo.

2. Materials and Methods

2.1. Cultures

HEp-2 cells [34] werepurchased from the American Type CultureCollection (ATCC). Routine maintenancewas conducted using complete growth medium (CGM) [10]. S. aureus RN6390 [32, 33, 35] provided by A. Cheung(Dartmouth Medical School) was used to infect HEp-2 cells using establishedtechniques described previously [8, 32, 33, 36]. Briefly,bacteria from 16-hour Todd Hewitt broth cultures were washedthree times with phosphate buffered saline (PBS), and resuspended in invasionmedium (IM; CGM lacking antibiotics and FBS) to makestocks with approximately 109 colony-forming units (CFU) mL−1. Bacterial stocks were diluted 10-fold infresh IM; 500 μL of thecell suspension well−1 were used to infect each HEp-2 culture at amultiplicity of infection (MOI) of 10. The cocultures were centrifuged immediately to synchronize monolayerinfections and incubated at 37°C for 10 minutes to allow internalization, after10 minutes, the IM was rapidly replaced with fresh medium containing gentamicin(100 μg mL−1) to kill noninternalized bacteria. Thereafter, the cocultures were incubated (upto 8 hours following S. aureus exposure) and analyzed at various timesfollowing exposure to S. aureus asdescribed below.

For growth rateanalyses, cells from 16-hour S. aureus RN6390 TH broth cultures (above)were pelleted, washed three times with PBS, and diluted with PBS to 105 CFU mL−1. A 100 μL aliquotwas inoculated into 10 mL of TH broth or IM, with or without FBS (withoutantibiotics). Cultures were incubatedwith vigorous shaking up to 8 hours. CFU concentrations weredetermined by a standard plate count method.

2.2. RNA Isolation and Purification

HEp-2 cells wereharvested at 2, 4, 6, or 8 hours following addition of bacteria. RNA was isolated using TRIZOL (Invitrogen)according to the manufacturer's instructions and further purified with RNAeasyMinElute Cleanup Kits (Qiagen). RNAsamples, quantified using a NanoDrop ND-1000spectrophotometer (Nanodrop Technologies)and showing OD260:OD280 ratios >1.95were used for subsequent experiments.

2.3. Microarray Methods and Data Analysis

MWG Human 30K microarrays(MWG) were used according to the manufacturer'sinstructions. cDNA wassynthesized using the BD Atlas PowerScript Fluorescent Labeling Kit (BD) witholigo(dT)12-18 primer (Invitrogen). CyDye Post-Labeling Reactive Dyes (Amersham) were used to fluorescentlylabel the cDNA (Cy3 for cDNA from uninfected cells and Cy5 for cDNA from S. aureus infected cells). Unincorporated dye was removed from labeledcDNA with CHROMA SPIN+TE-30 columns (Clontech). Labeled cDNA was dissolved in salt-based hybridization buffer (MWG),incubated at 95°C (3 minutes), chilled on ice, and hybridized to the microarraychips in the dark for 16–24 hours at 42°Cwith slow rocking. Arrays were washedand scanned with an Axon 4000A dual channel microarray scanner (Axon) togenerate multi-TIFF images which were processed with GenePix Pro 6.0 software(Molecular Devices).

2.4. Quantitative Real-Time PCR (QRT-PCR)

QRT-PCR was usedto validate selected microarray data. cDNA was synthesized from 1 μgof RNA using Superscript Π Reverse Transcriptase (Invitrogen). Primers (Table 1), designed using PrimerExpress 2.0 software (PE Applied Biosystems), were purchased from IntegratedDNA Technologies (IDT). Data were analyzed as described previously [37]. The threshold cycle (CT) was calculated as the cycle number at which the ΔRn crossed thebaseline. Data were normalized bycalculating ΔCT[CT of target− CT of the internal control(β-actin)]. Normalized ΔCTdata from S. aureus infected HEp-2cells were compared to data from uninfected HEp-2 cells by calculating ΔΔCTCTof S. aureus infected HEp-2 cells − ΔCT of uninfected HEp-2 cells]. Each experiment was conducted thrice forvalidation, and the mean value is reported.

2.5. Cholesterol Analyses

HEp-2 cells weredislodged with TrypLE Express (Gibco) and collected by centrifugation. Lipids were extracted with chloroform andmethanol [38], analyzed and quantified bygas chromatography/mass spectrometry (GC-MS 6890N; Agilent Technologies) and reported as μg/105 cells. Eachexperiment was conducted at least three times.

2.6. Flow Cytometry

Prior toinfection, S. aureus was labeled with0.5 μM 5- (and-6)-carboxyfluoresceindiacetate, succinimidyl ester (CFSE) (Invitrogen) for 10 minutes at 37°C. CFSE-stained S. aureuswas washed three times with PBS and used toinfect HEp-2 cells as described above. After coculturing for 10 minutes,cells were washed and incubated (15 minutes, 37°C) with S. aureus specific antibody ab37644 (Abcam), followed by goat antimouse IgG conjugated withCy5 (Southern Biotech) to quantify extracellular bacteria. In parallel experiments to quantifyextracellular bacteria, infected monolayers were treated with lysostaphin for 2 hours resulting in loss of the CFSEsignal. Confirmation of theeffectiveness of lysostaphin treatment was accomplished by treatment withCy5-conjugated antibody as described above. Cells were harvested and analyzed with a FACSAria flow cytometer (BD),equipped with FACSDiva software (BD).

2.7. Statistical Analyses

GeneSpring version7.2 (Silicon Genetics) was used to analyze microarray data. For each time point, data from 3–5 separatereplicated experiments were obtained and analyzed by 2-way ANOVA (P < .05) to determine their validity, followed by Benjamini and Hochberg falsediscovery rate correction for each data set [39]. Correction for spot intensity variationsamong arrays was performed by intensity-dependent normalization and subtractionof background based on negative controls. Normalized mean values were determined for all data points. Microarray data were reported as increased ordecreased expression (>1.0 or <1.0, resp.) by dividing the meanCy5 value (infected HEp-2 cells) by the mean Cy3 value (uninfected HEp-2 cells)for each time point.

3. Results and Discussion

3.1. Experimental Model

As this study wasdesigned to assess the effects of internalized S. aureus on the HEp-2 pharyngeal epithelial cell line, theinfluences of extracellular bacteria or their exotoxins produced prior tointernalization of S. aureus wereminimized by (1) thoroughly washing the inocula; (2) treating cocultures with gentamicinafter a very short (10 minutes) extracellular bacterial exposure; (3)conducting the extracellular exposure period in a medium that does not supportextracellular growth. Specifically,unlike control cultures in TH broth which supported robust growth, S. aureus RN6390 cultured in IM did notgrow, even when incubated for periods of time much longer than the 10 minutesused to infect cells (Figure 1). Furthermore, IM supplemented with FBSsupported moderate growth, indicating that a lack of growth in IM alone was notdue to inhibitory components.

Considering the short exposure of HEp-2cells to extracellular S. aureus, it was of interest to quantify thepercentage of infected HEp-2 cells containing intracellular bacteria. This was accomplished by differentialstaining of intracellular and extracellular bacteria and by monitoringintracellular CFSE-stained S. aureus following lysostaphin treatment to remove extracellularbacteria. As shown in Figure 2(a), a 10-minute-exposureresulted in monolayers in which approximately 57.0% of the HEp-2 cellscontained cell-associated S.aureus (extracellular and/or intracellular), while approximately 39.0% of HEp-2 cellswere associated with extracellular bacteria (Figure 2(b)). Lysostaphin treatment which removed nearlyall extracellular bacteria (Figure 2(d)) revealed that approximately 43.2% ofthe HEp-2 cells had intracellular S. aureus (Figure 2(c)).

3.2. Microarray and QRT-PCR Data Analysis

Intracellular S. aureus altered expression of several classes of HEp-2 genes. Genes with statistically validated alteredtranscription levels >1.50-fold (increase or decrease) at any of the four-time-pointsin microarrays are listed in Table 2. Toavoid potential pitfalls associated with amplification of mRNA such as inferiorreducibility, mRNA was not amplified in this study. The microarray data shown here representedtrue transcription levels. Although wesuspect that relatively low mRNA levels resulted in microarray data for somesamples which were notstatistically significant (P > .05), data for selected genes of interest were validated by QRT-PCR(summarized in Table 3). Data not shownin Table 2 resulted from signal intensities <50 which were too low toquantify.

3.3. Stress Response

Theadaptor-related protein complex 1 (AP-1) comprises JUN, FOS, and activatingtranscription factor (ATF) proteins; it regulates a variety of activitiesincluding proliferation, apoptosis, and inflammation in response to stresssignals, cytokines, growth factors, and microbial infections [40, 41]. Internalization of S. aureus induced a rapid (7.89-fold) increase in atf3 mRNA levels at 2 hourspostinfection that rapidly declined thereafter, as measured by microarrayanalysis (Table 2). QRT-PCR analysisyielded consistent findings (Table 3). Other AP-1 genes, such as c-fos, fosB, c-jun, and junB,were up-regulated as measured by microarray and/or QRT-PCR analysis, albeitless dramatically at 2 hours. Anotherstress response gene, sgk, encodingserum and glucocorticoid-induced protein kinase (SGK) [42], was up-regulated maximallyat 2 hours (Tables 2 and 3). SGK isinvolved in epithelial sodium transport, and is induced in epithelial cells inresponse to environmental stimuli and stress [42].

3.4. Signal Transduction

Intracellular S. aureus also affected genes involvedin several mitogen-activated protein kinase (MAPK) pathways. MAPK kinase 1 (map2k1) mRNA levelsgradually increased and reached a maximum level at 8 hours (Table 2), MAPK kinase1 activates downstream extracellular signal-regulated protein kinases (ERKs) inthe Ras-Raf-MEK-ERK pathway. Two Rashomolog genes, arhe and arhb, were generally up-regulated >1.50-fold throughout the 8-hour-infection (Tables 2 and 3), whereas, the Ras inhibitor gene, ack-1, was down-regulated (Table 2). Thus, up-regulation of map2k1, arhe, and arhb, anddown-regulation of the inhibitor ack-1 are consistent with activation of Ras-ERK pathway. Ras proteins are important for cytoskeletonreorganization [43, 44], coinciding with bacterial uptake and intracellular movement. Transcription of another MAPK gene (map2k3), a dual-specific kinase thatphosphorylates MAPK14 (p38), was up-regulated >1.50-fold at all four-time-points(Tables 2 and 3). P38 pathway plays an important role inregulating proinflammatory gene expression including tnfa, il1b, and cox2 [43, 44].

Staphylococcalactivation of the ERK and P38 pathways in epithelial cells has also beenobserved in previous studies [4547]. Activation of ERK and P38 pathways, inepithelial cells, was also seen in other intracellular pathogen infections suchas Helicobacter pylori [48] and Salmonella enterica [49].

3.5. Proinflammatory Response

Intracellularbacteria frequently up-regulate several proinflammatory cytokine genes (tnfa, il1b, and il6) andchemokine genes (il8, ccl20, and cxcl1) [15, 49, 50]. Due to the low transcriptional activity of il1b, tnfa, il6, cxcl1, and ccl20 in uninfected HEp2-cells, accurate comparison of these geneswas not obtained with microarray analysis. QRT-PCR analysis demonstrated that transcription of il1b, tnfa, il6, cxcl1, and ccl20 genes wasup-regulated (Table 3),although only small to moderate increases were observed, compared to previousstudy [22]. This finding is likely due to differences intypes of host cells and in S. aureus strains, and also due to the fact that we investigated only the effects ofintracellular staphylococci. Forexample, human umbilical endothelial cells infected with a clinical S. aureus isolate, were inducedexpression of several proinflammatory cytokines/chemokines with similar fold changes to ourstudy at transcriptional level. However, it did not induce expression of either tnfa, or ilb, which was different from our study [26]. Similarly, vaginalepithelial cells cocultured simultaneously with intracellular and extracellular S. aureus MNSM, producing toxic shocksyndrome toxin-1, for 3 hours showed increases in the transcription of il8, cxcl1,and ccl20 (11.3-fold, 17.1-fold and207.9-fold, resp.) which were much stronger than our results [22].

Cyclooxygenase-2 gene (cox2), an inducible form of the cyclooxygenase-1 gene(cox1), was up-regulated at allfour-time-points in this study (Tables 2 and 3). As an immediate early response gene that isresponsible for prostanoid biosynthesis involved in proinflammation, cox2 is expressed in epithelial cells,macrophages, fibroblasts, and vascular endothelial cells [51]. COX2 isinduced by IL-1β [52] and lipoteichoic acid from S. aureus [53]. Up-regulation of cox2 transcription was also associated with infection of epithelialcells by gram-negative bacteria: Y. enterocolitica [13] and S. flexneri M90T, probably via LPS [15]. The induction of cox2 expression is not significantly in vaginal epithelial cellcultures infected (intracellular plus extracellular) with the superantigenproducing strain S. aureus MNSM (see above) [22], further emphasizing the potentially different effects caused by various S. aureus strains, as well as the systems employed to measure their effects.

3.6. Cell Proliferation and Proapoptosis

Intracellular S. aureus RN6390 affected transcriptionof several proapoptotic genes. Dickkopf-1 (dkk1), wasup-regulated >2.00-fold at all time points examined (Tables 2 and 3). Krüppel-like factors 4 and 6 genes (klf4 and klf6) were up-regulated>2.00-fold at 2 hours postinfection (Table 2). Microarray data showed the gene for caspase-9(casp9) up-regulated ~2.00-fold at 2 hours (Table 2), and this resultwas confirmed by QRT-PCR (Table 3). Thegene (bnip3) encoding Bcl2/adenovirusE1B 19kDa interacting protein 3, a mitochondrial proapoptotic protein, wasup-regulated >2.00-fold at both 6 hours and 8 hours (Table 2). Two insulin-like growth factor bindingprotein genes (igfbp1 and igfbp3) were up-regulated >1.50-fold at 4 hours, 6 hours, and 8 hourspostinfection (Tables 2 and3). The NR4A1 receptor gene (nur77), which encodes a transcriptionfactor that exhibits proapoptotic properties in T cells [54], was up-regulated ~6-fold at 2 hours (Table 2). These findings were similar to severalstudies demonstrating that the infection of epithelial cells [8, 28, 32, 33], endothelial cells [29, 30, 55, 56], and osteoblasts [3, 57, 58]with S. aureus can lead toapoptosis. Previous work in our lab hadshown the involvement of host caspases 3 and 8 in S. aureus-induced apoptosis [32] and the requirement of the S. aureus virulence gene regulator agr in the induction of epithelial cellapoptosis [33].

3.7. Profibrotic Gene Transcription in HEp-2 Cells

TGFβ1 is a keyprotein involved in many cell functions including fibrosis formation,regulation of cell cycle, apoptosis, and matrix remodeling [59]. QRT-PCRindicated that tgfβ1 wasup-regulated by intracellular S. aureus (Table 3). Intracellular S. aureus also induced transcription of several genes related toTGFβ1, especially in regard tofibrosis formation (Tables 2 and 3). In microarray experiments, transforminggrowth factor beta receptor 2 gene (tgfβr2)and epidermal growth factor receptor (EGFR)gene (v-erb-b) were up-regulated >1.5-fold after 4 hours (Table 2). Integrin α5 gene (itga5) was gradually up-regulated after 2-hour-infection(Table 2). The gene (thbs1) encodingthrombospondin 1 was up-regulated ~3.00-fold at 4 hours and 2.54-fold at 6 hours in microarrayexperiments (Table 2), and similarly, with QRT-PCR (Table 3).

Plasminogenactivator inhibitor 1 and 2 genes (pai1, pai2) were up-regulated inmicroarray experiments (Table 2). Studies have shown that TGFβ1 induces plasminogen activator inhibitor 1(PAI1) expression and demonstrated therequirement for EGFR in this process [6062]. Both PAI1 and PAI2 are inhibitors of thefibrinolysis system, acting to block the activity of tissue plasminogenactivator and urokinase, and preventing the conversion of plasminogen toplasmin. Plasmin is a serine proteasethat degrades fibrin clots as well as extracellular matrix components. Thus, up-regulation of pai1 and pai2 may reduce extracellular matrix degradation.

The CCN(Cysteine-rich 61, Connective tissue growth factor, and Nephroblastomaoverexpressed) family members are cysteine-rich and functionally diverseproteins that are involved in mitosis, apoptosis, adhesion, extracellularmatrix production, angiogenesis, and tumor growth [63]. Three genes belonging to the CCN family wereup-regulated. Two of those, cyr61 and ctgf, were significantly up-regulated at early time points (Table 2 and 3). The third CCN gene, nov, was significantly up-regulated after 4 hours at transcriptional level (Table 2). An increasedtranscription of cyr61 and ctgf genes has been shown during epithelial cell infection with Y. enterocolitica [13], S. flexneri [15], and B. pertussis [16]. CYR61, CTGF, and NOV have the capability to bind both fibronectin and α5β1 integrin, similar to IGFBP1 andIGFBP3 [6468], and are implicated in wound healing [68]. Takentogether, up-regulation of these profibrotic genes indicates that intracellular S. aureus might affect the extracellular matrix bystimulating fibrosis and aidingin repair of the damage causedby S. aureus infection.

3.8. Cholesterol Biosynthesis

Intracellular S. aureus caused down-regulatedexpression of cholesterol biosynthesis enzyme genes, including sterol-c4-methyloxidase-like (sc4mol),3-hydroxy-3-methylglutaryl-coenzyme A reductase (hmgcr), hydroxysteroid (17β) dehydrogenase 7 (hsd17b7), isopentenyl-diphosphate delta isomerase (idi1), squalene monooxygenase (sqle), sterol c5-desaturase-like (sc5dl), farnesyl-disphosphatefamesyltransferase 1 (fdft1), and7-dehydrocholesterol reductase (dhcr7). Genes involved in regulation of cholesterolsynthesis were also down-regulated. Insulin-inducedgene 1 (insig1), encoding a membraneendoplasmic reticulum protein, was down-regulated (0.20-fold at 4 hours,0.26-fold at 6 hours, and 0.41-fold at 8 hours) (Table 2). Acetyl CoAsynthetase gene (acas2) and low-density lipoprotein receptor gene (ldlr) were also transcriptionallydown-regulated (Table 2). QRT-PCR dataconfirmed the down-regulation of hmgcr, sqle, dhcr7, and ldlr (Table 3). Cholesterol quantification with GC-MSalso showed that host cells displayeda corresponding decreased cholesterol synthesis after a challenge withintracellular S. aureus (Table 4). Garner et al. showed an essentialrole for cholesterol in the uptake of S. typhimurium into HeLa cells, demonstrating that the removal of cholesterolcaused a greater than 90%decrease in bacterial uptake [69]. Thus, a reduction in cholesterol may be a response to limit theinternalization of S. aureus. In addition, a decrease in cholesterol levelscould limit the effects of S. aureus exotoxins on the host cell membrane. S. aureus alpha toxin, along with other pore-forming toxins from Streptococcus and Clostridium species, showed reduced activity when cholesterol levelsin lipid membranes were decreased [70, 71]. A recent study showed that the golden S. aureus pigment, staphyloxanthin, issynthesized with the same substrates used for cholesterol biosynthesis by hostcells [72]. It is unclear at present whetherthe effect on cholesterol biosynthesis is related to this finding; however, itis conceivable that this effect might represent a host response to affectproduction of this staphylococcal virulence factor.

In summary, thisstudy demonstrates that several classes of genes in HEp-2 cells undergo changesin transcriptional expression in response to intracellular S. aureus. Weobserved that, in the first few hours of intracellular infection, epithelialcells can respond to intracellular S. aureus quickly by inducing earlystress response (AP-1 complex) and MAPK pathways (Ras, P38), which consequentlystimulate broader responsessuch as proinflammatory response, apoptosis, and fibrosis. Our data support the belief that the role of epithelial cells in innateimmunity is not simply that of a physical barrier against invading pathogens,but it is also activelyinvolved in the induction of more complex host defense mechanisms. Another possibility is that, as a successfulpathogen, intracellular S. aureus might lead to host geneexpression that facilitates itsintracellular survival. This isconsistent with induction of Ras-related cytoskeleton reorganization and the fibrosis process. Our results are also consistent with,although not definitive of, a delicate balance between effects which benefitthe host and those which are more beneficial to S. aureus. Finally, thisstudy showed that intracellular S. aureus suppressed cholesterol synthesis in epithelial cells. The consequence of thissuppression on the pathogenesis of S. aureus is not clearly presented but might be related to recent observations regarding staphylococcalpigment production.

Figure 1

Growth analysisof S. aureus RN6390. To assessgrowth, S. aureus RN6390was inoculated into different media (TH broth, IM, or IMsupplemented with FBS). CFUswere determined hourly by a standardplate count method up to 8 hours, and represented as the mean ± SEM of dataacquired from three experiments.

Figure 2

Assessment of S. aureus RN6390 internalization usingflow cytometry. Dotted lines indicate the uninfected HEp-2 cell control, andsolid lines indicate HEp-2 cells infected with CFSE-labeled S. aureus ((a)and (c)) or infected with CFSE-labeled S. aureus followed by labeling Cy5-conjugated mAb specific for S. aureus ((b)and (d)). In panels (a) and (b), HEp-2 cells were infected with CFSE-labeled S. aureus without treatment withlysostaphin. CFSE signal represents HEp-2 cells infected with extracellularand/or intracellular S. aureus (a). Cy5 signal represents HEp-2 cells infected with extracellular S. aureus only (b). In panels (c) and(d), HEp-2 cells were infected with CFSE-labeled S. aureus followed by the treatment with lysostaphin which degradesstaphylococcal cell wall causing a loss of CFSE signal by extracellular S. aureus. CFSE signal represents HEp-2cells infected with intracellular S. aureus only (c). This was confirmed by showing the loss of Cy5 signal inpanel (d). Data shown are from a representative experiment which was conductedthree times.

Table 1
DNA primersused for QRT-PCR experiments.
GeneForwardprimers (5′-3′)Reverseprimers (5′-3′)
atf3GATGTCCTCTGCGCTGGAATCCTCGGCTTTTGTGATGGA
c-fosGCCCTTTGATGACTTCCTGTTCGGAGCGGGCTGTCTCAGA
c-junGCAAAGATGGAAACGACCTTCTGCTCTCGGACGGGAGGAA
junBCTACACGACTACAAACTCCTGAAACCCCCCAGGCGCTTTGAGA
sgkGTGCCTGGGAGCTGTCTTGTGCTGTGTTTCGGCTATAAAAAGG
arhbTCCCAATGTGCCCATCATCATGCGGGCCAGCTCTGT
map2k3CCCTACATGGCCCCTGAGATCCAGACGTCGGACTTGACA
Il1bCGAATCTCCGACCACCACTACTCCATGGCCACAACAACTGA
tnfaCCTGGTATGAGCCCATCTATCTGTAGTCGGGCCGATTGATCTC
Il6AGCCGCCCCACACAGATCGAGGATGTACCGAATTTGTTT
Il8CTGGCCGTGGCTCTCTTGCTTGGCAAAACTGCACCTTCA
ccl20TCCTGGCTGCTTTGATGTCAAAAGTTGCTTGCTGCTTCTGATT
cxcl1AACATCCAAAGTGTGAACGTGAAGAGTGTGGCTATGACTTCGGTTT
Il10CTTGTCTGAGATGATCCAGTTTTACCTCCTTGATGTCTGGGTCTTGGTT
ptgs2GGAAGCCTTCTCTAACCTCTCCTATTAGGGAGTCGGGCAATCATC
admGGATGTCGCGTCGGAGTTTTGCTGGACATCCGCAGTTC
dkk1AAGTACCAGACCATTGACAACTACCAGGGACTAGCGCAGTACTCATCAGT
igfbp1CCATCTGATGGCCCCTTCTCCTTCGAGCCATCATAGGTACTG
casp9AGGACATGCTGGCTTCGTTTTTCTAGGGTTGGCTTCGACAA
tgfb1CCTGGCGATACCTCAGCAACCGGTGACATCAAAAGATAACCA
thbs1TCCGCAAAGTGACTGAAGAGAATGAACTCCGTTGTGATAGCATAGG
cyr61GGTGGAGTTGACGAGAAACAATGAGGGAGCCGCTTCAGTGA
hmgcrCCCAGTTGTGCGTCTTCCATGCGAACCCTTCAGATGTTTC
sqleCGCCCTCTTCTCGGATATTCTCCGAGCTGCTCCTTATTTTCTG
dhcr7AGCCGCCCAGCTCTATACCTTTATGGCAGAAGTCAGGGAGAGA
ldlrGATGAAGTTGGCTGCGTTAATGTCGCCGCTGTGACACTTGA
actbCGTTGCTATCCAGGCTATGCTTCACCGGAGTCCATCACGAT
Table 2
Microarray analysis of gene expression changes in infected HEp-2 cellmonolayers.
CategoryGeneFoldchange (P value)
2 h4 h6 h8 h
Stress responseatf37.89 (.024)1.53 (.113)2.00 (.041)0.85 (.189)
c-fos2.59 (.052)1.21 (.072)0.911 (.302)0.843 (.287)
fosB2.29 (.009)1.14 (.605)0.95 (.919)1.10 (.101)
c-jun1.88 (.011)1.40 (.094)0.77 (.064)1.27 (.035)
junB1.98 (.007)1.16 (.015)1.22 (.015)1.03 (.407)
sgk4.17 (.018)2.16 (.005)1.84 (.178)2.13 (.066)

Signal transductionmap2k11.23 (.835)1.52 (.025)1.80 (.030)2.86 (.041)
arhe2.61 (.005)2.31 (.060)1.26 (.370)1.70 (.085)
arhb2.21 (.044)2.18 (.004)1.78 (.065)1.60 (.022)
ack-10.67 (.061)0.56 (.081)0.39 (.004)0.51 (.026)
map2k31.98 (.014)2.41 (.003)1.96 (.127)2.33 (.052)

Proinflammatory responsecox23.32 (.012)2.71 (.088)1.29 (.065)2.55 (.064)

Cell proliferation andproapoptosisdkk12.17 (.026)7.11 (.001)3.23 (.012)4.52 (.055)
klf42.33 (.001)1.78 (.134)1.61 (.008)1.61 (.104)
klf62.51 (.019)1.50 (.064)1.52 (.046)1.62 (.090)
Igfbp12.54 (.062)4.32 (.001)2.13 (.086)11.10 (.030)
Igfbp30.77 (.664)1.80 (.051)3.65 (.003)2.23 (.088)
casp91.95 (.015)1.57 (.021)0.54 (.617)0.78 (.666)
bnip31.25 (.073)1.64 (.034)2.86 (.002)2.47 (.041)
nur776.17 (.038)1.28 (.181)0.78 (.114)0.87 (.235)

Profibrotictgfbr21.47 (.011)1.67 (.083)2.09 (.008)2.10 (.010)
v-erb-b0.96 (.608)1.67 (.055)1.96 (.005)2.11 (.007)
itga50.88 (.768)2.19 (.037)2.12 (.033)3.20 (.030)
thbs11.28 (.112)2.93 (.001)2.54 (.024)2.44 (.209)
pai12.45 (.006)1.80 (.040)1.27 (.089)1.32 (.136)
pai2ND2.09 (.015)4.43 (.001)4.13 (.013)
cyr614.43 (.007)3.24 (.001)2.33 (.152)1.61 (.249)
ctgf6.78 (.026)2.13 (.141)NDND
nov1.46 (.301)1.98 (.059)2.05 (.002)2.15 (.006)

Cholesterol synthesissc4mol0.81 (.367)0.32 (.001)0.36 (.001)0.31 (.001)
hmgcr1.11 (.700)0.30 (.002)0.21 (.001)0.36 (.016)
hsd17b70.74 (.189)0.50 (.001)0.30 (.006)0.31 (.014)
idi11.00 (.979)0.53 (.018)0.33 (.004)0.31 (.151)
sqle0.90 (.397)0.50 (.007)0.26 (.001)0.31 (.008)
sc5dl0.90 (.358)0.45 (.017)0.23 (.008)0.35 (.064)
fdft10.96 (.551)0.59 (.002)0.29 (.001)0.26 (.010)
dhcr70.95 (.527)0.63 (.010)0.51 (.016)0.39 (.014)
insig10.69 (.338)0.20 (.001)0.26 (.001)0.41 (.014)
acas2ND0.58 (.080)0.27 (.001)0.37 (.024)
ldlr1.09 (.048)0.41 (.002)0.54 (.017)0.68 (.114)
ND:Not determined. Data not shown due to low signal intensity (<50).
Table 3
Validation of selected genes by QRT-PCR.
CategoryGeneFoldchange (P value)
2 h4 h6 h8 h
Stress responseatf315.45 (.001)4.46 (.005)1.38 (.004)1.97 (.027)
c-fos4.55 (.001)1.32 (.005)1.47 (.001)1.86 (.001)
c-jun2.93 (.001)1.26 (.001)1.77 (.001)2.91 (.001)
junb3.60 (.001)1.26 (.001)1.37 (.008)2.29 (.004)
sgk3.36 (.001)1.20 (.001)1.87 (.001)2.02 (.001)

Signal transductionarhb2.61 (.002)1.80 (.001)2.17 (.001)1.71 (.019)
map2k31.57 (.001)1.89 (.013)2.04 (.005)2.12 (.001)

Proinflammatory responseil1b3.64 (.001)1.58 (.007)2.02 (.001)1.47 (.002)
tnfa3.36 (.001)1.30 (.009)2.21 (.001)1.43 (.001)
il62.65 (.001)1.87 (.001)2.96 (.001)1.55 (.004)
ccl206.29 (.001)5.07 (.002)4.53 (.001)1.82 (.001)
cxcl13.82 (.001)2.41 (.001)2.87 (.001)3.05 (.050)
cox24.16 (.001)3.69 (.001)3.96 (.001)2.95 (.011)

Cell proliferation and Proapoptosisdkk13.43 (.001)6.90 (.001)4.31 (.001)2.28 (.001)
igfbp13.50 (.001)6.82 (.045)4.20 (.010)9.89 (.001)
casp92.74 (.001)1.34 (.005)1.42 (.004)1.13 (.021)

Profibrotictgfb11.55 (.002)1.20 (.023)1.71 (.001)2.66 (.001)
thbs11.83 (.001)4.55 (.001)4.12 (.002)4.09 (.001)
cyr613.31 (.001)4.01 (.002)2.28 (.016)2.44 (.001)

Cholesterol synthesishmgcr1.25 (.025)0.17 (.001)0.15 (.001)0.17 (.001)
sqle1.00 (.005)0.30 (.001)0.14 (.001)0.15 (.001)
dhcr71.17 (.050)0.50 (.001)0.27 (.001)0.16 (.001)
ldlr1.57 (.010)0.09 (.001)0.12 (.001)0.23 (.001)
Table 4

Cholesterolquantification [(μg/105 cells) ± SD] in uninfectedand infected HEp-2 cellmonolayers.

CelltypeIncubation time (h)
2468
Unchallenged HEp-2 cell75.82 ± 2.9969.78 ± 5.3164.94 ± 5.0055.91 ± 4.78
Challenged HEp-2 cell58.43 ± 3.7351.92 ± 2.8750.74 ± 5.2243.38 ± 3.36
% cholesterol reduction22.9125.6021.8722.41

P value.005.050.045.026

Acknowledgments

This work was supported, in part, by the IdahoAgricultural Experiment Station, and Public Health Service grants,U54-AI-57141, P20-RR016454, and P20-RR15587. The authors are grateful to Darren Schnider for assistance in preparingthis manuscript. The first two authors contributed equally to this work.

References

  • 1. KuehnertMJKruszon-MoranDHillHAPrevalence of Staphylococcus aureus nasal colonization in the United States, 2001-2002The Journal of Infectious Diseases20061932172179[PubMed][Google Scholar]
  • 2. BohachGAFastDJNelsonRDSchlievertPMStaphylococcal and streptococcal pyrogenic toxins involved in toxic shock syndrome and related illnessesCritical Reviews in Microbiology1990174251272[PubMed][Google Scholar]
  • 3. AlexanderEHHudsonMCFactors influencing the internalization of Staphylococcus aureus and impacts on the course of infections in humansApplied Microbiology and Biotechnology2001563-4361366[PubMed][Google Scholar]
  • 4. ProctorRAKahlBvon EiffCVaudauxPELewDPPetersGStaphylococcal small colony variants have novel mechanisms for antibiotic resistanceClinical Infectious Diseases199827supplement 1S68S74[PubMed][Google Scholar]
  • 5. ProctorRAvon EiffCKahlBCSmall colony variants: a pathogenic form of bacteria that facilitates persistent and recurrent infectionsNature Reviews Microbiology200644295305[PubMed][Google Scholar]
  • 6. SpellerDCEJohnsonAPJamesDMarplesRRCharlettAGeorgeRCResistance to methicillin and other antibiotics in isolates of Staphylococcus aureus from blood and cerebrospinal fluid, England and Wales, 1989–95The Lancet19973509074323325[Google Scholar]
  • 7. AlmeidaRAMatthewsKRCifrianEGuidryAJOliverSPStaphylococcus aureus invasion of bovine mammary epithelial cellsJournal of Dairy Science199679610211026[PubMed][Google Scholar]
  • 8. BaylesKWWessonCALiouLEFoxLKBohachGATrumbleWRIntracellular Staphylococcus aureus escapes the endosome and induces apoptosis in epithelial cellsInfection and Immunity1998661336342[PubMed][Google Scholar]
  • 9. BeekhuizenHvan de GevelJSOlssonBvan BentenIJvan FurthRInfection of human vascular endothelial cells with Staphylococcus aureus induces hyperadhesiveness for human monocytes and granulocytesThe Journal of Immunology19971582774782[PubMed][Google Scholar]
  • 10. DziewanowskaKCarsonARPattiJMDeobaldCFBaylesKWBohachGAStaphylococcal fibronectin binding protein interacts with heat shock protein 60 and integrins: role in internalization by epithelial cellsInfection and Immunity2000681163216328[PubMed][Google Scholar]
  • 11. SinhaBFrançoisPPNüßeOFibronectin-binding protein acts as Staphylococcus aureus invasin via fibronectin bridging to integrin α5β1Cellular Microbiology199912101117[PubMed][Google Scholar]
  • 12. VesgaOGroeschelMCOttenMFBrarDWVannJMProctorRAStaphylococcus aureus small colony variants are induced by the endothelial cell intracellular milieuThe Journal of Infectious Diseases19961733739742[PubMed][Google Scholar]
  • 13. BohnEMüllerSLauberJGene expression patterns of epithelial cells modulated by pathogenicity factors of Yersinia enterocoliticaCellular Microbiology200462129141[PubMed][Google Scholar]
  • 14. EckmannLSmithJRHousleyMPDwinellMBKagnoffMFAnalysis by high density cDNA arrays of altered gene expression in human intestinal epithelial cells in response to infection with the invasive enteric bacteria SalmonellaThe Journal of Biological Chemistry2000275191408414094[PubMed][Google Scholar]
  • 15. PédronTThibaultCSansonettiPJThe invasive phenotype of Shigella flexneri directs a distinct gene expression pattern in the human intestinal epithelial cell line caco-2The Journal of Biological Chemistry2003278363387833886[PubMed][Google Scholar]
  • 16. BelcherCEDrenkowJKehoeBThe transcriptional responses of respiratory epithelial cells to Bordetella pertussis reveal host defensive and pathogen counter-defensive strategiesProceedings of the National Academy of Sciences of the United States of America200097251384713852[PubMed][Google Scholar]
  • 17. DanelishviliLMcGarveyJLiY-JBermudezLEMycobacterium tuberculosis infection causes different levels of apoptosis and necrosis in human macrophages and alveolar epithelial cellsCellular Microbiology200359649660[PubMed][Google Scholar]
  • 18. IchikawaJKNorrisABangeraMGInteraction of Pseudomonas aeruginosa with epithelial cells: identification of differentially regulated genes by expression microarray analysis of human cDNAsProceedings of the National Academy of Sciences of the United States of America2000971796599664[PubMed][Google Scholar]
  • 19. BaldwinDNVanchinathanVBrownPOTheriotJAA gene-expression program reflecting the innate immune response of cultured intestinal epithelial cells to infection by Listeria monocytogenesGenome Biology200341, article R2114[Google Scholar]
  • 20. NakagawaINakataMKawabataSHamadaSTranscriptome analysis and gene expression profiles of early apoptosis-related genes in Streptococcus pyogenes-infected epithelial cellsCellular Microbiology2004610939952[PubMed][Google Scholar]
  • 21. MoreilhonCGrasDHologneCLive Staphylococcus aureus and bacterial soluble factors induce different transcriptional responses in human airway cellsPhysiological Genomics200520244255[PubMed][Google Scholar]
  • 22. PetersonMLAultKKremerMJThe innate immune system is activated by stimulation of vaginal epithelial cells with Staphylococcus aureus and toxic shock syndrome toxin 1Infection and Immunity200573421642174[PubMed][Google Scholar]
  • 23. DziewanowskaKPattiJMDeobaldCFBaylesKWTrumbleWRBohachGAFibronectin binding protein and host cell tyrosine kinase are required for internalization of Staphylococcus aureus by epithelial cellsInfection and Immunity199967946734678[PubMed][Google Scholar]
  • 24. EllingtonJKElhofyABostKLHudsonMCInvolvement of mitogen-activated protein kinase pathways in Staphylococcus aureus invasion of normal osteoblastsInfection and Immunity200169952355242[PubMed][Google Scholar]
  • 25. EllingtonJKReillySSRampWKSmeltzerMSKellamJFHudsonMCMechanisms of Staphylococcus aureus invasion of cultured osteoblastsMicrobial Pathogenesis1999266317323[PubMed][Google Scholar]
  • 26. MatussekAStrindhallJStarkLInfection of human endothelial cells with Staphylococcus aureus induces transcription of genes encoding an innate immunity responseScandinavian Journal of Immunology2005616536544[PubMed][Google Scholar]
  • 27. HessDJHenry-StanleyMJEricksonEAWellsCLIntracellular survival of Staphylococcus aureus within cultured enterocytesJournal of Surgical Research200311414249[PubMed][Google Scholar]
  • 28. KahlBCGoulianMvan WamelWStaphylococcus aureus RN6390 replicates and induces apoptosis in a pulmonary epithelial cell lineInfection and Immunity200068953855392[PubMed][Google Scholar]
  • 29. MenziesBEKourtevaIInternalization of Staphylococcus aureus by endothelial cells induces apoptosisInfection and Immunity1998661259945998[PubMed][Google Scholar]
  • 30. MenziesBEKourtevaIStaphylococcus aureus α-toxin induces apoptosis in endothelial cellsFEMS Immunology and Medical Microbiology20002913945[PubMed][Google Scholar]
  • 31. MuraiMSakuradaJSekiKShinjiHHirotaYMasudaSApoptosis observed in BALB/3T3 cells having ingested Staphylococcus aureusMicrobiology and Immunology1999437653661[PubMed][Google Scholar]
  • 32. WessonCADeringerJLiouLEBaylesKWBohachGATrumbleWRApoptosis induced by Staphylococcus aureus in epithelial cells utilizes a mechanism involving caspases 8 and 3Infection and Immunity200068529983001[PubMed][Google Scholar]
  • 33. WessonCALiouLEToddKMBohachGATrumbleWRBaylesKWStaphylococcus aureus Agr and Sar global regulators influence internalization and induction of apoptosisInfection and Immunity1998661152385243[PubMed][Google Scholar]
  • 34. MooreAESabachewskyLToolanHWCulture characteristics of four permanent lines of human cancer cellsCancer Research1955159598602[PubMed][Google Scholar]
  • 35. CheungALChienY-TBayerASHyperproduction of alpha-hemolysin in a sigB mutant is associated with elevated SarA expression in Staphylococcus aureusInfection and Immunity199967313311337[PubMed][Google Scholar]
  • 36. ShompoleSHenonKTLiouLEDziewanowskaKBohachGABaylesKWBiphasic intracellular expression of Staphylococcus aureus virulence factors and evidence for Agr-mediated diffusion sensingMolecular Microbiology2003494919927[PubMed][Google Scholar]
  • 37. SeoKKLeeSUParkYHDavisWCFoxLKBohachGALong-term staphylococcal enterotoxin C1 exposure induces soluble factor-mediated immunosuppression by bovine CD4+ and CD8+ T cellsInfection and Immunity2007751260269[PubMed][Google Scholar]
  • 38. ClarkRMFerrisAMFeyMBrownPBHundrieserKEJensenRGChanges in the lipids of human milk from 2 to 16 weeks postpartumJournal of Pediatric Gastroenterology and Nutrition198213311315[PubMed][Google Scholar]
  • 39. DetteHMunkAOptimum allocation of treatments for Welch's test in equivalence assessmentBiometrics199753311431150[PubMed][Google Scholar]
  • 40. FolettaVCSegalDHCohenDRTranscriptional regulation in the immune system: all roads lead to AP-1Journal of Leukocyte Biology1998632139152[PubMed][Google Scholar]
  • 41. WisdomRAP-1: one switch for many signalsExperimental Cell Research19992531180185[PubMed][Google Scholar]
  • 42. LeongMLLMaiyarACKimBO'KeeffeBAFirestoneGLExpression of the serum- and glucocorticoid-inducible protein kinase, Sgk, is a cell survival response to multiple types of environmental stress stimuli in mammary epithelial cellsThe Journal of Biological Chemistry2003278858715882[PubMed][Google Scholar]
  • 43. JohnsonGLLapadatRMitogen-activated protein kinase pathways mediated by ERK, JNK, and p38 protein kinasesScience2002298560019111912[PubMed][Google Scholar]
  • 44. MacheskyLMHallARole of actin polymerization and adhesion to extracellular matrix in Rac- and Rho-induced cytoskeletal reorganizationJournal of Cell Biology19971384913926[PubMed][Google Scholar]
  • 45. HanniganMZhanLAiYHuangC-KThe role of p38 MAP kinase in TGF-β1-induced signal transduction in human neutrophilsBiochemical and Biophysical Research Communications199824615558[PubMed][Google Scholar]
  • 46. KyriakisJMAvruchJMammalian mitogen-activated protein kinase signal transduction pathways activated by stress and inflammationPhysiological Reviews2001812807869[PubMed][Google Scholar]
  • 47. RaingeaudJGuptaSRogersJSPro-inflammatory cytokines and environmental stress cause p38 mitogen-activated protein kinase activation by dual phosphorylation on tyrosine and threonineThe Journal of Biological Chemistry19952701374207426[PubMed][Google Scholar]
  • 48. TummalaSKeatesSKellyCPUpdate on the immunologic basis of Helicobacter pylori gastritisCurrent Opinion in Gastroenterology2004206592597[PubMed][Google Scholar]
  • 49. GuineyDGThe role of host cell death in Salmonella infectionsCurrent Topics in Microbiology and Immunology2005289131150[PubMed][Google Scholar]
  • 50. EckmannLKagnoffMFFiererJEpithelial cells secrete the chemokine interleukin-8 in response to bacterial entryInfection and Immunity1993611145694574[PubMed][Google Scholar]
  • 51. SmithWLGaravitoRMDeWittDLProstaglandin endoperoxide H synthases (cyclooxygenases)-1 and -2The Journal of Biological Chemistry1996271523315733160[PubMed][Google Scholar]
  • 52. MaierJAMHlaTMaciagTCyclooxygenase is an immediate-early gene induced by interleukin-1 in human endothelial cellsThe Journal of Biological Chemistry1990265191080510808[PubMed][Google Scholar]
  • 53. LinC-HKuanI-HLeeH-MInduction of cyclooxygenase-2 protein by lipoteichoic acid from Staphylococcus aureus in human pulmonary epithelial cells: involvement of a nuclear factor-κB-dependent pathwayBritish Journal of Pharmacology20011343543552[PubMed][Google Scholar]
  • 54. WoroniczJDCalnanBNgoVWinotoARequirement for the orphan steroid receptor Nur77 in apoptosis of T-cell hybridomasNature19943676460277281[PubMed][Google Scholar]
  • 55. EsenMSchreinerBJendrossekVMechanisms of Staphylococcus aureus induced apoptosis of human endothelial cellsApoptosis200166431439[PubMed][Google Scholar]
  • 56. Haslinger-LöfflerBKahlBCGrundmeierMMultiple virulence factors are required for Staphylococcus aureus-induced apoptosis in endothelial cellsCellular Microbiology20057810871097[PubMed][Google Scholar]
  • 57. AlexanderEHRiveraFAMarriottIAnguitaJBostKLHudsonMCStaphylococcus aureus—induced tumor necrosis factor—related apoptosis—inducing ligand expression mediates apoptosis and caspase-8 activation in infected osteoblastsBMC Microbiology20033, article 5111[PubMed][Google Scholar]
  • 58. TuckerKAReillySSLeslieCSHudsonMCIntracellular Staphylococcus aureus induces apoptosis in mouse osteoblastsFEMS Microbiology Letters20001862151156[PubMed][Google Scholar]
  • 59. LeeCGKangH-RHomerRJChuppGEliasJATransgenic modeling of transforming growth factor-β1: role of apoptosis in fibrosis and alveolar remodelingProceedings of the American Thoracic Society200635418423[PubMed][Google Scholar]
  • 60. ArnolettiJPAlboDGranickMSThrombospondin and transforming growth factor-beta 1 increase expression of urokinase-type plasminogen activator and plasminogen activator inhibitor-1 in human MDA-MB-231 breast cancer cellsCancer19957669981005[PubMed][Google Scholar]
  • 61. KutzSMHigginsCESamarakoonRTGF-β1-induced PAI-1 expression is E box/USF-dependent and requires EGFR signalingExperimental Cell Research2006312710931105[PubMed][Google Scholar]
  • 62. KutzSMHordinesJMcKeown-LongoPJHigginsPJTGF-β1-induced PAI-1 gene expression requires MEK activity and cell-to-substrate adhesionJournal of Cell Science20011142139053914[PubMed][Google Scholar]
  • 63. BrigstockDRThe CCN family: a new stimulus packageJournal of Endocrinology20031782169175[PubMed][Google Scholar]
  • 64. GleesonLMChakrabortyCMckinnonTLalaPKInsulin-like growth factor-binding protein 1 stimulates human trophoblast migration by signaling through α5β1 integrin via mitogen-activated protein kinase pathwayThe Journal of Clinical Endocrinology & Metabolism200186624842493[PubMed][Google Scholar]
  • 65. GuiYMurphyLJInsulin-like growth factor (IGF)-binding protein-3 (IGFBP-3) binds to fibronectin (FN): demonstration of IGF-I/IGFBP-3/FN ternary complexes in human plasmaThe Journal of Clinical Endocrinology & Metabolism200186521042110[PubMed][Google Scholar]
  • 66. JonesJIGockermanABusbyWHJr.WrightGClemmonsDRInsulin-like growth factor binding protein 1 stimulates cell migration and binds to the α5β1 integrin by means of its Arg-Gly-Asp sequenceProceedings of the National Academy of Sciences of the United States of America199390221055310557[PubMed][Google Scholar]
  • 67. LeaskAAbrahamDJAll in the CCN family: essential matricellular signaling modulators emerge from the bunkerJournal of Cell Science20061192348034810[PubMed][Google Scholar]
  • 68. LinCGChenC-CLeuS-JGrzeszkiewiczTMLauLFIntegrin-dependent functions of the angiogenic inducer NOV (CCN3): implication in wound healingThe Journal of Biological Chemistry2005280982298237[PubMed][Google Scholar]
  • 69. GarnerMJHaywardRDKoronakisVThe Salmonella pathogenicity island 1 secretion system directs cellular cholesterol redistribution during mammalian cell entry and intracellular traffickingCellular Microbiology200243153165[PubMed][Google Scholar]
  • 70. GiddingsKSJohnsonAETwetenRKRedefining cholesterol's role in the mechanism of the cholesterol-dependent cytolysinsProceedings of the National Academy of Sciences of the United States of America2003100201131511320[PubMed][Google Scholar]
  • 71. TomitaTWatanabeMYasudaTInfluence of membrane fluidity on the assembly of Staphylococcus aureus α-toxin, a channel-forming protein, in liposome membraneThe Journal of Biological Chemistry1992267191339113397[PubMed][Google Scholar]
  • 72. LiuC-ILiuGYSongYA cholesterol biosynthesis inhibitor blocks Staphylococcus aureus virulenceScience2008319586813911394[PubMed][Google Scholar]
Collaboration tool especially designed for Life Science professionals.Drag-and-drop any entity to your messages.