Am J Physiol Heart Circ Physiol 302(3): H770-H781

PMC: PMC3353790

PMID: 22081699

Constitutive overexpression of phosphomimetic phospholemman S68E mutant results in arrhythmias, early mortality, and heart failure: potential involvement of Na<sup>+</sup>/Ca<sup>2+</sup> exchanger

Blaise Peterson+2 authors

METHODS

Generation of PLM S68E TG mouse.

A cardiac-specific and inducible controlled vector (TREMHC) composed of a modified mouse α-myosin heavy chain (MHC) minimal promoter fused with nucleotide binding sites for tetracycline transactivator (tTA) was used to provide robust expression when turned on in the absence of doxycycline (Dox) and minimal leakage when turned off in the presence of Dox (23). Sequence-verified dog PLM S68E gene (279 bp) together with 5′-untranslated (60 bp) and 3′-untranslated (200 bp) sequences (35) was cloned into TREMHC vector and microinjected into the nuclei of FVB mice for transgenic mice production (34). Eleven TG founders were generated, but only 10 (4 males and 6 females) survived. Founder line 95 (male) died at 18 wk of unknown causes. To quantify the number of TG inserted into the genome, genomic DNA from mouse tail was isolated using the Qiagen DNAeasy kit. Genomic DNA (100 ng) was used for real-time PCR using PLM S68E-specific primer set (forward: ATCGTCCTGAGCAGAAGATGCCGGT; reverse: CCTGCGGGTCTCCAGACGGCGGATGGA) and GAPDH set (forward: AACGACCCCTTCATTGAC; reverse: TCCACGACATACTCAGCAC). Real-time PCR was performed in a 20 μl reaction (100 ng of genomic DNA; 500 nM of each primer; 1× SYBRE Green Master Mix). Each experimental sample was performed in triplicate. The ΔCT method was used to quantify the results, which are presented as relative-fold changes to the GAPDH gene.

Because expression of the TG required the presence of Dox-responsive transcription factor tTA, founder mice (with the exception of line 95) were healthy and fertile. To determine phenotype, TG founders (lines 39 and 90) were crossed to the cardiac tTA TG mice in FVB background (MHC-tTA). Littermates that were heterozygous for tTA but negative for S68E TG were referred to as wild-type (WT) controls. In the absence of dietary Dox for pregnant mothers and offsprings, S68E mutant was constitutively expressed (conS68E). All the data reported for conS68E mice were from founder line 39.

Mice were housed and fed on a 12-h:12-h light/dark cycle at the Thomas Jefferson University Animal Facility and were supervised by veterinary staff members. Standard care was provided to all mice used for experiments. All protocols applied to the mice were approved and supervised by the Institutional Animal Care and Use Committee at Thomas Jefferson University.

Echocardiographic and hemodynamic analyses of cardiac function.

Transthoracic two-dimensional echocardiography was performed in anesthetized (2% inhaled isoflurane) WT or conS68E mice with a 12-MHz probe as described previously (34–36). For in vivo hemodynamic measurements, a 1.4 French micromanometer-tipped catheter (SPR-671; Millar Instruments) was inserted into the right carotid artery and advanced into the left ventricle (LV) of lightly anesthetized (tribromoethanol/amylene hydrate; Avertin; 2.5% wt/vol, 8 μl/g ip) mice with spontaneous respirations and placed on a heated (37°C) pad (34–36). Hemodynamic parameters including heart rate (beats/min), LV end-diastolic (LVED) pressure, and maximal first time derivative of LV pressure rise (+dP/dt) and fall (−dP/dt) were recorded in closed-chest mode, both at baseline and in response to increasing doses of isoproterenol (Iso; 0.1, 0.5, 1, 5, and 10 ng) (34–36).

Isolation of adult murine cardiac myocytes.

Cardiac myocytes were isolated from the LV free wall and septum of WT and conS68E mice according to the protocol of Zhou et al. (49) and modified by us (29, 33–36). In all experiments, myocytes were used within 2–8 h of isolation except for [Na^]_i measurements in which myocytes cultured for 18 h were used (29, 35, 36). In this study, all functional studies were performed on myocytes isolated from 4-wk-old hearts.

Myocyte shortening measurements.

Myocytes adherent to coverslips were bathed in 0.7 ml of air- and temperature-equilibrated (37°C), HEPES-buffered (20 mM, pH 7.4) medium 199 containing 1.8 or 5.0 mM extracellular Ca^{concentration ([Ca}^]_o). Myocytes were field stimulated to contract (2 Hz) between platinum wire electrodes spaced 2 mm apart. Images of myocytes viewed through an Olympus DApoUV ×40/1.30 numerical aperture oil objective situated in a Zeiss IM35 inverted microscope were captured by a charge-coupled device video camera (Myocam; Ionoptix, Milton, MA). Edge detection algorithm was used to measure myocyte motion, and data were analyzed offline by Ionoptix software as described previously (29, 33–36).

[Ca^]_i transient measurements.

Fura-2 loaded (0.67 μM fura-2 AM, 15 min, 37°C) myocytes were field stimulated to contract (2 Hz, 37°C) in medium 199 containing 1.8 mM [Ca^]_o. Excitation light (360 and 380 nm) was directed to myocytes only during data acquisition. Epifluorescence (510 nm) collected by the Olympus ×40 oil objective was passed through a pinhole (1.6 mm; ∼20% of myocyte x-y area) and captured by a photomultiplier (Hamamatsu R928-07). Photomultiplier output was routed through an amplifier/discriminator (model C609; Thorn EMI, Middlesex, UK) before arrival at a counter/timer board (model C660; Thorn EMI). Photon counts were captured and analyzed offline with Ionoptix software. [Ca^]_i transient measurements, daily calibration of fura-2 fluorescent signals, and [Ca^]_i transient analyses were performed as described previously (29, 33–36).

[Na^]_i measurements.

[Na^]_i was measured in sodium-binding benzofuran isophthalate (SBFI)-loaded (10 μM SBFI AM with 0.05% wt/vol Pluronic F127, 2 h, 37°C) myocytes. Myocytes were field stimulated to contract (2 Hz, 37°C) in Tyrode's solution. Dual excitation wavelengths (340 and 380 nm alternating at 5 Hz) were directed to a single myocyte via a Nikon ×40/1.30 numerical aperture ultraviolet oil objective situated in a Nikon TE200U inverted microscope only during data acquisition. Emission (510 nm) from a small area of the myocyte was captured with a photomultiplier (Ionoptix). To minimize SBFI photobleaching and myocyte photodamage, emission data were collected at 60-s intervals. After 2 min when both contraction and [Ca^]_i transient amplitudes had reached steady-state values, Iso (1 μM) was added and [Na^]_i was followed for an additional 7 min. Calibration of SBFI signals was performed as described previously (35, 36).

Electrophysiological measurements.

Na^-K^{-ATPase current (}I_pump)(29, 35, 36, 43), Na^/Ca^{exchanger current (}I_NaCa) (29, 34, 35, 41), L-type Ca^{current (}I_Ca) (33, 34), and action potential (1 Hz) (33–35) were measured in isolated LV myocytes (30°C) with whole cell patch-clamp. Fire-polished pipettes (tip diameter, 4–6 μm) with resistances of 0.8–1.4 MΩ when filled with pipette solutions were used. Compositions of solutions and voltage protocols are given in the figure legends.

For measurement of depolarization-activated K^{currents, only myocytes isolated from LV free wall were used since the slow component of transient outward current (}I_to,s) is absent in this subset of mouse myocytes (39). Pipette solution contained (in mM) 135 KCl, 1 CaCl₂, 14 EGTA, 10 HEPES, and 5 MgATP (pH 7.1). ATP was included to block ATP-sensitive outward K^{current. External solution contained (in mM) 132 NaCl, 5.4 KCl, 1.8 CaCl}₂, 1.8 MgCl₂, 0.6 NaH₂PO₄, 10 HEPES, 0.5 CdCl₂, and 10 glucose (pH 7.4). CdCl₂ was added to block I_Ca and I_NaCa. Holding potential was at −70 mV. Voltage-gated K^{currents (30°C) were evoked during 5-s depolarizing voltage steps (from −40 to +60 mV; 10-mV increments). Myocytes were returned to −70 mV for 200 ms before the next voltage step. After identifying peak currents, the decaying phases of the currents were fitted with two exponentials of the form: A}₁e^₁ + A₂e^₂ + A_ss, where A₁, A₂, and A_ss are the amplitudes of fast component of the rapidly inactivating transient outward current (I_to,f), slowly inactivating K^{current (}I_K,slow), and noninactivating steady-state current (I_ss), respectively; and τ₁ and τ₂ are the time constants of decay of I_to,f and I_K,slow, respectively (39). Only values derived from curve fits with correlation coefficients of ≥0.97 were reported.

Immunoblotting.

Mouse LV homogenates were prepared as described previously (33). In some experiments homogenates from only the atria were prepared. For detection of S68E mutant (12% SDS-PAGE, reducing conditions with 5% β-mercaptoethanol), either monoclonal B8 (1:10,000) or polyclonal C2 antibody (1:10,000) (28) was used. For detection of α₁- and α₂-subunits of Na^-K^{-ATPase, sarco(endo)plasmic reticulum Ca}^{-ATPase (SERCA2; 7.5% SDS-PAGE, reducing conditions), α}_1c-subunit of L-type Ca^{channel and calsequestrin (5% SDS-PAGE, reducing conditions), Na}^/Ca^{exchanger (7.5% SDS-PAGE, nonreducing conditions with 10 mM}N-ethylmaleimide), and cardiac ryanodine receptor (RyR2; 3–8% gradient gel, Tris-acetate, reducing conditions), commercially available antibodies were used as described previously (29, 33–36, 38).

Because S68E mutant was originally constructed from dog PLM (27), to estimate the fold protein overexpression of the mutant TG over native PLM present in mouse hearts, B8 antibody, which detects the NH₂ terminus of dog but not rat (27) or mouse (35) PLM, was used. To standardize B8 signals obtained from conS68E LV against endogenous PLM present in dog LV, hearts were excised from immediately euthanized (3,900 mg pentobarbital iv) male Hound Mix dogs (6–8 mo old, ∼20 kg; Marshall Farms) that were anesthetized (fentanyl 0.004 mg/h iv; propofol 1 mg·kg^·h^{iv), ventilated (1.5% to 2.0% isoflurane), and received glucose-insulin infusions for the previous 24 h. Canine LV homogenates were prepared with a protocol similar to the one used for mouse hearts. The protocols (including LV harvesting) applied to dogs were approved and supervised by the Institutional Animal Care and Use Committee at Thomas Jefferson University.}

Statistics.

All results are expressed as means ± SE. For analysis of I_NaCa, I_Ca, and depolarization-activated K^{currents as a function of group (WT vs. conS68E) and voltage; in vivo hemodynamic parameters,}I_pump, [Ca^]_I, and [Ca^]_i transient amplitudes as a function of group and Iso; and contraction amplitudes as a function of group and [Ca^]_o, two-way ANOVA was used. For analysis of echocardiographic parameters, [Na^]_i, action potential parameters, and protein abundance, one-way ANOVA was used. A commercially available software package (JMP version 7; SAS Institute, Cary, NC) was used. In all analyses, P < 0.05 was taken to be statistically significant.

Generation of PLM S68E TG mouse.

Echocardiographic and hemodynamic analyses of cardiac function.

Isolation of adult murine cardiac myocytes.

Myocyte shortening measurements.

[Ca^]_i transient measurements.

[Na^]_i measurements.

Electrophysiological measurements.

Immunoblotting.

Statistics.

Generation of PLM S68E TG mouse.

Echocardiographic and hemodynamic analyses of cardiac function.

Isolation of adult murine cardiac myocytes.

Myocyte shortening measurements.

[Ca^]_i transient measurements.

[Na^]_i measurements.

Electrophysiological measurements.

Immunoblotting.

Statistics.

RESULTS

Transgenic mouse model constitutively overexpressing PLM S68E mutant.

The 10 founders (4 males and 6 females) harboring the dog S68E TG were all heterozygous. Analysis of mouse genomic DNA showed that all 10 surviving founder lines contained S68E TG. After crossing transgenic founder line 39 with homozygous MHC-tTA mice, in the absence of dietary Dox, mice that were heterozygous for both tTA and S68E TG (tTA^S68E^{) would constitutively express the TG (conS68E), whereas littermates that were heterozygous for tTA only (tTA}^S68E^{) were used as WT.}

At 4 wk of age, the level of S68E mutant protein (detected by B8 antibody) in conS68E LV (3105.3 ± 375.9 arbitrary units) was ∼38.3× that of endogenous PLM present in dog LV (81.0 ± 18.0 arbitrary units; Fig. 1A). B8 signals were not detectable in WT mouse LV, confirming our previous observations that B8 antibody recognizes dog but not mouse PLM.

An external file that holds a picture, illustration, etc.
Object name is zh40021202330001.jpg

Fig. 1.

Immunoblots of phospholemman (PLM) and S68E mutant in hearts. A: left ventricular (LV) homogenates were prepared from dog, wild-type (WT; tTA^S68E^{), and transgenic (tTA}^S68E^{) mice constitutively overexpressing dog PLM S68E mutant (conS68E) and subjected to SDS-PAGE followed by Western blot analysis.}Top: B8 antibody (1:5,000), which recognizes the NH₂ terminus of dog (27) but not rat or mouse (35) PLM, was used to detect dog PLM (10 μg/lane) and S68E mutant in WT (10 μg/lane) and conS68E (1 μg/lane) hearts. Bottom: C2 antibody (1:10,000) raised against the COOH terminus of rat PLM (28) was used to detect signals from dog (5 μg/lane), WT (5 μg/lane), and conS68E (0.2 μg/lane) hearts. B: LV homogenates were prepared from dogs, Spraque-Dawley (SD) rats, and C57BL/6 and FVB mice for Western blot analysis of PLM (C2 antibody; 1:10,000), α₁-subunit of Na^-K^{-ATPase (1:1,000), and calsequestrin (CLSQ; 1:2,000). Calsequestrin was used as protein loading control since its expression has been shown to be unchanged during ontogenic development, aging, cardiac hypertrophy, and failing human myocardium (}12). Protein loading for PLM, α₁-subunit of Na^-K^{-ATPase, and CLSQ was 5, 50, and 5 μg/lane, respectively. A totally unexpected finding was that C2 signals from C57BL/6 LV (12.4 ± 0.6 arbitrary units) were significantly (}P < 0.0025) lower than those from FVB LV (20.6 ± 1.8 arbitrary units), despite similar levels of α₁-subunit of Na^-K^{-ATPase between C57BL/6 (69.2 ± 3.9 arbitrary units) and FVB (81.1 ± 8.4 arbitrary units) LV (}P < 0.25). This suggests that either the conformation of COOH terminus of PLM differed between C57BL/6 and FVB hearts or the expression of PLM was lower in C57BL/6 LV. C: atrial homogenates were prepared from WT (5 μg/lane) and conS68E mice (1 μg/lane) and B8 antibody (1:5,000) was used to detect expression of S68E mutant. Dog LV homogenates (5 μg/lane) were used as positive controls for B8 antibody.

We next used C2 antibody, which was raised against a 16-amino acid peptide fragment of the COOH terminus of rat PLM (NH₂-CGTFRSSIRRLS^T^{RRR-COOH) (}28) to compare its efficiency to detect the COOH terminus of mouse PLM, which differs from that of dog, rat, or human PLM by one amino acid (T^{is replaced with S}^{). Heart homogenates were first treated with bacterial alkaline phosphatase to dephosphorylate PLM before blotting with C2. C2 detects dog (30.0 ± 8.4 arbitrary units) and rat (30.5 ± 3.5 arbitrary units) PLM equally well (}Fig. 1B). C2 signal for FVB LV was 73.0 ± 4.8% that for dog or rat LV (Fig. 1B; P < 0.03), indicating the single amino acid change from T^{to S}^{in FVB mouse PLM decreased the efficiency of C2 detection by ∼25%.}

C2 signals from WT and conS68E LV were 103.5 ± 14.5 and 5766.7 ± 928.7 arbitrary units, respectively (Fig. 1A). After correction for 75% detection efficiency by C2 for FVB PLM, S68E expression in conS68E LV was ∼41.1× that of endogenous PLM in WT LV. It is relevant to note that S68E was also expressed in atria of conS68E mice (Fig. 1C).

Constitutive overexpression of S68E mutant resulted in early mortality.

The most striking phenotype of conS68E mice was increased mortality starting after 4 wk (Fig. 2). At 22 wk, only one out of 20 WT mice died, whereas eight out of 15 conS68E mice perished (P < 0.02; log-rank test). Most of the mortality (7 out of 8 deaths) in conS68E mice occurred within 4–6 wk. Histological examination at 6 wk did not reveal increased cardiac fibrosis (Fig. 2).

An external file that holds a picture, illustration, etc.
Object name is zh40021202330002.jpg

Fig. 2.

Constitutive overexpression of S68E mutant results in early mortality and cardiac hypertrophy. Top: survival curve of WT (n = 20) and mice constitutively overexpressing S68E mutant (conS68E; n = 15). Bottom: hearts (n = 3 each for WT and conS68E mice) from 6-wk-old mice were sectioned and stained with Masson trichrome. Representative images from WT (left) and conS68E (right) hearts are shown.

As a first attempt to evaluate the cause of early demise in conS68E mice, we performed echocardiography at 4 wk before any mortality had occurred. When compared with WT mice, conS68E mice exhibited severe bradycardia, multifocal ventricular tachycardia, and ventricular flutter/fibrillation (Fig. 3). At 4 wk, 11 of 12 conS68E versus zero of 14 WT mice exhibited severe bradycardia (<250 beats/min), and four of 12 conS68E versus zero of 14 WT mice had ventricular flutter/fibrillation. Although conS68E mice were significantly smaller than their WT littermates, LV mass was significantly higher (Fig. 2; Table 1A). Heart rate in conS68E mice was <50% of that in WT animals so that despite larger stroke volume and higher ejection fraction, cardiac output (CO) was significantly lower in conS68E mice at 4 wk of age (Table 1A).

An external file that holds a picture, illustration, etc.
Object name is zh40021202330003.jpg

Fig. 3.

Constitutive overexpression of S68E mutant results in arrhythmias. Echocardiography was performed on 4-wk-old WT (top) and conS68E (middle and bottom) mice. EKG tracings demonstrate normal sinus rhythm in WT (top) but severe bradycardia, multifocal ventricular tachycardia (middle), and ventricular flutter/fibrillation (bottom) in conS68E hearts. Results of echographic parameters are given in Table 1.

Table 1.

Echocardiographic parameters of constitutively overexpressed PLM S68E mice

	Wild-type	ConS68E
4 wk
Body weight, g	18.8 ± 0.6 (14)	15.6 ± 0.8⁽¹²⁾
LV mass, mg	44.5 ± 2.2	53.6 ± 3.8⁺
Heart rate, beats/min	429 ± 12	204 ± 22^*
Ejection fraction, %	76.1 ± 1.5	89.5 ± 2.3^*
Fractional shortening, %	44.1 ± 1.4	61.1 ± 2.8^*
Stroke volume, μl	34.2 ± 1.6	51.4 ± 4.2^*
Cardiac output, ml/min	14.6 ± 0.7	10.3 ± 1.0^*
22 wk
Body weight, g	25.5 ± 0.5 (14)	27.0 ± 1.2 (7)
LV mass, mg	72.8 ± 2.2	92.8 ± 6.9^*
Heart rate, beats/min	458 ± 13	301 ± 38^*
Ejection fraction, %	71.9 ± 1.5	74.2 ± 2.6
Fractional shortening, %	40.6 ± 1.3	43.1 ± 2.2
Stroke volume, μl	40.9 ± 1.8	57.0 ± 4.5^*
Cardiac output, ml/min	18.5 ± 0.7	17.2 ± 2.4

Values are means ± SE for number of mice in parentheses. PLM, phospholemman; conS68E, transgenic mice constitutively overexpressing PLM S68E mutant; LV, left ventricle.

^P < 0.005; ^P < 0.05; wild-type vs. conS68E.

Whole cell capacitance (C_m), a measure of cell surface membrane area and therefore estimate of myocyte size, was not different between WT (165.6 ± 4.7 pF, n = 37) and conS68E (170.0 ± 4.9 pF, n = 35) myocytes isolated from 4-wk-old hearts. Higher LV mass with similar myocyte sizes and no demonstrable increase in cardiac fibrosis suggests myocardial hyperplasia in conS68E hearts.

Of the <50% conS68E mice that survived past the initial 6 wk of life, increased LV mass and bradycardia persisted although baseline CO was indistinguishable from WT littermates when examined at 22 wk (Table 1B). At 22 wk, four of seven conS68E survivors versus zero of 14 WT mice still demonstrated bradycardia (<350 beats/min), two of seven conS68E survivors had severe bradycardia (<250 beats/min), whereas one of seven conS68E versus zero of 14 WT mice exhibited ventricular tachycardia.

In vivo hemodynamic measurements corroborated echocardiographic findings in that resting +dP/dt and −dP/dt were similar between conS68E and WT mice examined at 22 wk (Table 2). However, conS68E survivors at 22 wk had blunted responses to β-adrenergic agonists: as evidenced by reduced chronotropic (maximal heart rate; P < 0.0001, group effect), inotropic (maximal +dP/dt; P < 0.02, group × Iso interaction effect), and lusitropic (maximal −dP/dt; P < 0.02, group effect) responses (Table 2).

Table 2.

In vivo hemodynamics of constitutively overexpressed PLM S68E mice

	Wild-type	ConS68E
Heart rate, beats/min	415 ± 18 (7)	256 ± 28⁽⁷⁾
+dP/dt, mmHg/s	6,965 ± 432	6,519 ± 280
−dP/dt, mmHg/s	6,455 ± 492	5,922 ± 570
Maximal
Heart rate, beats/min	478 ± 11	327 ± 17^*
+dP/dt, mmHg/s	11,539 ± 721	9,197 ± 655^*
−dP/dt, mmHg/s	9,097 ± 571	7,913 ± 1,212^*

Values are means ± SE for number of mice in parentheses studied at 18–22 wk of age. Maximal heart rate, maximal +dP/dt, and maximal −dP/dt are peak hemodynamic responses after 10 ng isoproterenol infusion.

^P < 0.02, wild-type vs. conS68E.

Effects of constitutive overexpression of S68E mutant on expression of selected proteins involved in EC coupling.

Arrhythmias and decreased CO in conS68E mice may be due to altered expression of ion transporters intimately involved in EC coupling. At 4 wk, only SERCA2 but not Na^/Ca^{exchanger, α}₁- and α₂-subunits of Na^-K^{-ATPase, and total and phosphorylated cardiac ryanodine receptor (RyR2) was lower in conS68E LV (}Fig. 4; Table 3). The α-subunit of L-type Ca^{channel was higher in conS68E LV (}Fig. 4; Table 3). At 22 wk, there were no differences in cardiac expression of SERCA2, Na^/Ca^{exchanger, and α}₁- and α₂-subunits of Na^-K^{-ATPase between conS68E survivors and WT animals (}Fig. 4; Table 3).

An external file that holds a picture, illustration, etc.
Object name is zh40021202330004.jpg

Fig. 4.

Constitutive overexpression of S68E mutant reduces LV expression of sarco(endo)plasmic reticulum Ca^{-ATPase (SERCA2) at 4 but not 22 wk.}Top: LV homogenates were prepared from 4-wk-old WT and conS68E mice and subjected to SDS-PAGE followed by Western blot analysis (methods). Protein loading for Na^/Ca^{exchanger (NCX1), SERCA2, α}₁- and α₂-subunits of Na^-K^{-ATPase, L-type Ca}^{channel (Ca}_v1.2), and calsequestrin (CLSQ) were 55, 40, 55, 55, 50, and 40 μg/lane, respectively. For cardiac ryanodine receptor (RyR2) and RyR2 phosphorylated at Ser^{(p-RyR2), LV crude membranes (40 μg/lane) prepared with a 2-step centrifugation protocol (}27) were used. C2 antibody was used to detect endogenous phospholemman + S68E mutant and B8 antibody was used to detect S68E mutant in WT (21 μg/lane) and conS68E (7 μg/lane) hearts. Bottom: Western blot analysis was performed on LV homogenates prepared from 22-wk-old WT and conS68E survivors. Protein loading was 50 μg/lane except for the detection of endogenous phospholemman and S68E mutant (C2) in WT (20 μg/lane) and conS68E (3.3 μg/lane) hearts. Composite results are presented in Table 3.

Table 3.

Effects of constitutive overexpression of PLM S68E on levels of selected proteins

	Wild-type	ConS68E
4 wk
NCX1	260.5 ± 9.2 (5)	244.1 ± 9.5 (4)
SERCA2	151.1 ± 5.5	101.3 ± 6.2^*
α₁, Na^-K^-ATPase	109.5 ± 11.9	101.4 ± 9.8
α₂, Na^-K^-ATPase	161.6 ± 5.9	161.4 ± 7.2
Ca_v1.2	111.1 ± 12.6	135.3 ± 2.5^*
RyR2	184.0 ± 14.3	192.5 ± 48.8
p-RyR2	160.2 ± 21.4	123.0 ± 17.3
Calsequestrin	380.2 ± 13.2	330.3 ± 31.0
22 wk
NCX1	223.4 ± 2.3 (5)	225.9 ± 6.9 (4)
SERCA2	526.2 ± 27.0	529.6 ± 43.1
α₁, Na^-K^-ATPase	218.0 ± 9.4	196.2 ± 5.8
α₂, Na^-K^-ATPase	91.8 ± 17.3	105.4 ± 22.3
Calsequestrin	465.9 ± 21.1	416.0 ± 39.6

Values (in arbitrary units) are means ± SE. Numbers in parentheses are numbers of hearts. NCX1, cardiac Na^/Ca^{exchanger; PLM, phospholemman; SERCA2, sarco(endo)plasmic reticulum Ca}^{-ATPase; Ca}_v1.2, α-subunit of L-type Ca^{channel; RyR2, cardiac ryanodine receptor; p-RyR2, ryanodine receptor phosphorylated at serine}^.

^P < 0.02, wild-type versus conS68E.

Effects of constitutive overexpression of S68E mutant on action potential.

As a first approach to evaluate arrhythmias in conS68E mice, we measured action potential in WT and conS68E LV myocytes isolated from 4-wk-old mice. Resting E_m and action potential amplitude were similar between WT and conS68E myocytes (Fig. 5). The most striking finding is a doubling of action potential duration (APD) in conS68E myocytes (Fig. 5).

An external file that holds a picture, illustration, etc.
Object name is zh40021202330005.jpg

Fig. 5.

Constitutive overexpression of S68E mutant prolongs action potential (AP) duration (APD). Myocytes were paced at 1 Hz. Pipette solution consisted of (in mM) 125 KCl, 4 MgCl₂, 0.06 CaCl₂, 10 HEPES, 5 K^{-EGTA, 3 Na}₂ATP, and 5 Na₂-creatine phosphate (pH 7.2). External solution consisted of (in mM) 132 NaCl, 5.4 KCl, 1.8 CaCl₂, 1.8 MgCl₂, 0.6 NaH₂PO₄, 7.5 HEPES, 7.5 Na^{-HEPES, and 5 glucose (pH 7.4;}A). Action potentials from WT (dotted line) and conS68E (solid line) myocytes were recorded using current-clamp configuration at 1.5× threshold stimulus, 4-ms duration, and at 30^{C (}31, 33, 45, 48). B: means ± SE of resting membrane potential (E_m), action potential amplitude, and APD at 50% (APD₅₀) and at 90% repolarization (APD₉₀) from 14 WT and 15 conS68E myocytes are shown. *P < 0.01, WT vs. conS68E.

Effects of constitutive overexpression of S68E mutant on I_NaCa, I_pump, and I_Ca.

As expected from the results of our previous studies on S68E mutant (29, 35), constitutive overexpression of S68E mutant significantly (P < 0.0001 for group, voltage, and group × voltage interaction effects) inhibited I_NaCa (Fig. 6). I_pump was significantly (P < 0.0001) lower in conS68E myocytes by ∼41.7% (Fig. 7). In the presence of Iso, I_pump increased by 0.62 ± 0.09 pA/pF in WT but only by 0.10 ± 0.01 pA/pF in conS68E myocytes (Fig. 7; P < 0.0002). Peak density of I_Ca was significantly (P < 0.005) decreased by ∼29.2%, and there was ∼10 mV right shift of the test potential at which maximal I_Ca occurred in conS68E myocytes (Fig. 8). The inactivation time constant measured at peak I_Ca (fitted with a monoexponential) was 21.8 ± 1.9 ms in conS68E myocytes (n = 10) and not different (P < 0.3) than that (25.2 ± 2.2 ms) measured in WT myocytes (n = 12).

An external file that holds a picture, illustration, etc.
Object name is zh40021202330006.jpg

Fig. 6.

Constitutive overexpression of S68E mutant inhibits Na^/Ca^{exchanger current (}I_NaCa). Pipette solution contained (in mM) 100 Cs^{glutamate, 7.25 NaCl, 1 MgCl}₂, 20 HEPES, 2.5 Na₂ATP, 10 EGTA, and 6 CaCl₂ (pH 7.2). Free Ca^{in the pipette solution was 205 nM, measured fluorimetrically with fura-2. External solution contained (in mM) 130 NaCl, 5 CsCl, 1.2 MgSO}₄, 1.2 NaH₂PO₄, 5 CaCl₂, 10 HEPES, 10 Na^{HEPES, and 10 glucose (pH 7.4). Verapamil (1 μM) was used to block L-type Ca}^{current (}I_Ca). Our measurement conditions were biased toward measuring outward (3 Na^{out: 1 Ca}ⁱⁿ⁾I_NaCa. A: after holding the myocyte at the calculated reversal potential (−73 mV) of I_NaCa for 5 min (to minimize fluxes through NCX1 and thus allowed [Na^]_i and [Ca^]_i to equilibrate with those in pipette solution), I_NaCa (30^{C) was measured in WT and conS68E myocytes using a descending (from +100 to −120 mV; 500 mV/s) and ascending (from −120 to +100 mV; 500 mV/s) voltage ramp, first in the absence and then in the presence of 1 mM NiCl}₂. B: raw currents measured in a WT myocyte. I_NaCa was defined as the difference current measured in the absence and presence of Ni^{during the descending voltage ramp. Note that with the exception of small contamination of the ascending ramp by the cardiac Na}^{current, there were little to no differences in currents measured between the descending and ascending voltage ramps. This suggests that [Ca}^]_i and [Na^]_i sensed by NCX1 did not appreciably change by NCX1 fluxes during the brief (880 ms) voltage ramp. I_NaCa was divided by C_m before comparisons. C: current-voltage relationships of I_NaCa (means ± SE) from WT (▴; n = 6) and conS68E (◊; n = 12) myocytes are shown. The reversal potential of I_NaCa was ∼−60 mV, close to the theoretical reversal potential of −73 mV. Error bars are not shown if they fall within the boundaries of the symbol. I_NaCa data are fitted with 3^{order polynomial equation.}

An external file that holds a picture, illustration, etc.
Object name is zh40021202330007.jpg

Fig. 7.

Constitutive overexpression of S68E mutant decreases Na^-K^{ATPase current (}I_pump) and blunts the increase to isoproterenol (Iso). Myocytes were held at 0 mV and 30°C. Pipette solution contained (in mM) 70 Na^{-aspartate, 20 K}^{-aspartate, 8 CsOH, 7 MgSO}₄, 11 EGTA, 10 TEA-Cl, 1 CaCl₂, 5 HEPES, 5 Na₂ATP, and 0.2 GTP (pH 7.2). External solution contained (in mM) 137.7 NaCl, 18 KCl, 2.3 NaOH, 1 MgCl₂, 2 BaCl₂, 1 CdCl₂, 5 HEPES, and 10 glucose (pH 7.4). A: current from a WT myocyte is shown. After baseline current was recorded, isoproterenol (1 μM) was added. After current reached a new steady state, dihydroouabain (DHO; 1 mM) was added. Resting I_pump was defined as the difference between baseline current in the absence and presence of DHO (36). B: current densities (means ± SE) of I_pump from WT (n = 16) and conS68E (n = 12) myocytes, in the absence (white columns) or presence (black columns) of 1 μM of isoproterenol are shown. #P < 0.0001, WT vs. conS68E (with or without Iso); *P < 0.0002, WT vs. WT + Iso.

An external file that holds a picture, illustration, etc.
Object name is zh40021202330008.jpg

Fig. 8.

Constitutive overexpression of S68E mutant reduces L-type Ca^{current (}I_Ca). Pipette solution contained (in mM) 100 CsCl, 10 NaCl, 20 TEA, 10 HEPES, 5 MgATP, and 10 EGTA (pH 7.2 with CsOH). External solution contained (in mM) 137 NaCl, 5.4 CsCl, 1.8 CaCl₂, 1.3 MgSO₄, 1.2 NaH₂PO₄, 20 HEPES, 4 4-aminopyridine, and 15 glucose (pH 7.4 with NaOH). Before myocyte stimulation was started, holding potential was changed from −70 to −40 mV to inactivate fast inward Na^{current. To ensure steady-state SR Ca}^{loading, 6 conditioning pulses (from −40 to 0 mV, 300 ms, 1 Hz) were delivered before arrival of each test pulse (from −30 to +40 mV, 10-mV increments, 400 ms). After the last test pulse at +40 mV, myocyte was held at −40 mV for 1 s before being returned to holding potential of −70 mV. Leak-subtracted inward currents were used in analysis of}I_Ca amplitudes and inactivation kinetics. A: voltage-clamp protocol and I_Ca from a WT myocyte are shown. For clarity of presentation, only I_Ca measured at −30, −10, and +10 mV are shown. Inward currents measured under these conditions were completely abolished by 1 μM verapamil (data not shown). B: I_Ca from a conS68E myocyte measured at −30, −10, and +10 mV. C: after normalizing I_Ca to C_m, current-voltage relationships (means ± SE) from 12 control (▴) and 10 conS68E (●) myocytes are shown. Error bars are not shown if they fall within the boundaries of a symbol. *P < 0.03.

Effects of constitutive overexpression of S68E mutant on depolarization-activated K^currents.

Peak amplitudes of depolarization-activated K^{currents were significantly (group,}P < 0.0001; voltage, P < 0.0001; group × voltage interaction effects, P < 0.025) lower in conS68E myocytes compared with WT myocytes (Fig. 9). When depolarization-activated K^{currents were segregated into their respective components (}39), conS68E myocytes consistently had significantly (group, P < 0.0001; voltage, P < 0.0001 for all 3 currents; group × voltage interaction effects, P < 0.02 except for I_ss in which P < 0.28) lower I_to,f, I_K,slow, and I_ss (Fig. 9). The time constants of decay (at +40 mV) for I_to,f were similar (81.2 ± 6.1 ms, WT; 70.3 ± 10.3 ms, conS68E), but those for I_K,slow were significantly (P = 0.0002) prolonged in conS68E (1530.8 ± 139.7 ms) compared with WT (846.5 ± 56.8 ms) myocytes.

An external file that holds a picture, illustration, etc.
Object name is zh40021202330009.jpg

Fig. 9.

Constitutive overexpression of S68E mutant decreases depolarization-activated K^{currents. Depolarization-activated K}^{currents (30°C, 135 mM [K}^]_i) were measured in WT (▴; n = 9) and conS68E (◊, n = 7) myocytes isolated from the LV free wall (methods). A and B: tracings of depolarization-activated K^{currents from control and conS68E myocytes, respectively. K}^{currents were separated into 3 components (}methods). Current-voltage relationships of peak currents (C), fast component of transient outward currents (I_to,f; D), slowly inactivating K^{currents (}I_K,slow; E), and steady state noninactivating K^{currents (}I_ss; F) are shown. Values are means ± SE. Error bars are not shown if they fall within the boundaries of a symbol. Data for K^{currents are fitted by linear regression.}

Effects of constitutive overexpression of S68E mutant on [Ca^]_i transients, myocyte contractility, and [Na^]_i.

Diastolic [Ca^]_i was significantly (P < 0.015, group effect) higher in conS68E myocytes, both in the presence and absence of Iso (Table 4). Systolic [Ca^]_i was not different at baseline but significantly lower in conS68E myocytes after stimulation with Iso (P < 0.015, group × Iso interaction effect) (Table 4). As a result, [Ca^]_i transient amplitudes were significantly (P < 0.015, group × Iso interaction effect) lower in conS68E myocytes (Table 4). The half-time (t_1/2) of [Ca^]_i transient decline, a measure of in situ SR Ca^{uptake (}44), was significantly (P < 0.0001, group effect) longer in conS68E myocytes (Table 4), indicating decreased SR Ca^{uptake activity. This observation is consistent with reduced SERCA2 protein expression in 4-wk-old conS68E hearts (}Fig. 4 and Table 3).

Table 4.

Effects of constitutive overexpression of PLM S68E on [Ca^]_i transients

Iso	Wild-type	conS68E
	Diastolic [Ca^]_i, nM
−	109.1 ± 6.3 (28)	122.6 ± 3.5⁽³⁷⁾
+	94.4 ± 8.3 (15)	112.9 ± 7.4⁽¹⁷⁾
	Systolic [Ca^]_i, nM
−	224.0 ± 11.3	234.4 ± 8.4
+	558.7 ± 45.0	462.5 ± 28.0^*
	[Ca^]_i transient amplitude, % increase in fura-2 signal
−	18.9 ± 1.1	17.7 ± 0.7^*
+	58.1 ± 3.9	46.4 ± 3.7^*
	t_1/2 of [Ca^]_i transient decline, ms
−	107 ± 4	130 ± 4^*
+	61 ± 2	73 ± 3^*

Values are means ± SE. Numbers in parentheses are numbers of myocytes isolated from 4 wild-type and 4 conS68E mice. Myocytes were incubated at 1.8 mM [Ca^]_o, 37°C and paced at 2 Hz. Intracellular Ca^{concentration ([Ca}^]_i) values were measured before and 2 min after addition of 1 μM isoproterenol (Iso). t_1/2, half-time.

^P < 0.02, wild-type versus conS68E.

Alterations in [Ca^]_i homeostasis would be expected to affect myocyte contractility. Indeed, maximal contraction amplitude was significantly (P < 0.0002, group effect) lower in conS68E myocytes, especially at 5 mM [Ca^]_o (P < 0.02, group × [Ca^]_o interaction effect; Fig. 10).

An external file that holds a picture, illustration, etc.
Object name is zh40021202330010.jpg

Fig. 10.

. Constitutive overexpression of S68E mutant alters myocyte contractility. LV myocytes isolated from WT and conS68E mice were paced (1 Hz) to contract at 37°C and 1.8 or 5.0 mM [Ca^]_o (methods). A: steady state twitches are shown. B: means ± SE of maximal contraction amplitudes (% resting cell length) from 14 WT and 11 conS68E myocytes incubated at 1.8 mM [Ca^]_o (white columns) and from 20 WT and 18 conS68E myocytes measured at 5.0 mM [Ca^]_o (black columns) are shown. *P < 0.02, group × [Ca^]_o interaction effect.

When paced at 2 Hz, [Na^]_i increased by ∼4 mM after 2 min in both WT and conS68E myocytes (Fig. 11). Addition of Iso resulted in [Na^]_i reaching a peak within 3 min followed by decline in WT myocytes (Fig. 11), as we (35, 36) and others (8) have demonstrated previously. In conS68E myocytes, however, [Na^]_i reached a plateau following Iso addition (Fig. 11). This is consistent with decreased I_pump (Fig. 7), in addition to reduced Na^{entry due to inhibition of NCX1 by S68E mutant (}Fig. 6).

An external file that holds a picture, illustration, etc.
Object name is zh40021202330011.jpg

Fig. 11.

Changes in [Na^]_i with pacing and isoproterenol (Iso) treatment in myocytes. Increases in [Na^]_i from baseline (Δ[Na^]_i) were measured at 37°C in sodium-binding benzofuran isophthalate-loaded myocytes (methods). After resting [Na^]_i was obtained (at −1 min), pacing (2 Hz) was started at time 0. Iso (1 μM) was added at ∼2 min when both [Ca^]_i transient and contraction amplitudes have reached steady state. There are 10 WT (●) and 11 conS68E (○) myocytes. Error bars are not shown if they fall within the boundaries of a symbol. *P < 0.03, WT vs. conS68E. For WT, data are fitted with spline; for conS68E, data are fitted with power function.

Transgenic mouse model constitutively overexpressing PLM S68E mutant.

Fig. 1.

Constitutive overexpression of S68E mutant resulted in early mortality.

Fig. 2.

Fig. 3.

Table 1.

Echocardiographic parameters of constitutively overexpressed PLM S68E mice

	Wild-type	ConS68E
4 wk
Body weight, g	18.8 ± 0.6 (14)	15.6 ± 0.8⁽¹²⁾
LV mass, mg	44.5 ± 2.2	53.6 ± 3.8⁺
Heart rate, beats/min	429 ± 12	204 ± 22^*
Ejection fraction, %	76.1 ± 1.5	89.5 ± 2.3^*
Fractional shortening, %	44.1 ± 1.4	61.1 ± 2.8^*
Stroke volume, μl	34.2 ± 1.6	51.4 ± 4.2^*
Cardiac output, ml/min	14.6 ± 0.7	10.3 ± 1.0^*
22 wk
Body weight, g	25.5 ± 0.5 (14)	27.0 ± 1.2 (7)
LV mass, mg	72.8 ± 2.2	92.8 ± 6.9^*
Heart rate, beats/min	458 ± 13	301 ± 38^*
Ejection fraction, %	71.9 ± 1.5	74.2 ± 2.6
Fractional shortening, %	40.6 ± 1.3	43.1 ± 2.2
Stroke volume, μl	40.9 ± 1.8	57.0 ± 4.5^*
Cardiac output, ml/min	18.5 ± 0.7	17.2 ± 2.4

Values are means ± SE for number of mice in parentheses. PLM, phospholemman; conS68E, transgenic mice constitutively overexpressing PLM S68E mutant; LV, left ventricle.

^P < 0.005; ^P < 0.05; wild-type vs. conS68E.

Table 2.

In vivo hemodynamics of constitutively overexpressed PLM S68E mice

	Wild-type	ConS68E
Heart rate, beats/min	415 ± 18 (7)	256 ± 28⁽⁷⁾
+dP/dt, mmHg/s	6,965 ± 432	6,519 ± 280
−dP/dt, mmHg/s	6,455 ± 492	5,922 ± 570
Maximal
Heart rate, beats/min	478 ± 11	327 ± 17^*
+dP/dt, mmHg/s	11,539 ± 721	9,197 ± 655^*
−dP/dt, mmHg/s	9,097 ± 571	7,913 ± 1,212^*

^P < 0.02, wild-type vs. conS68E.

Effects of constitutive overexpression of S68E mutant on expression of selected proteins involved in EC coupling.

Fig. 4.

Table 3.

Effects of constitutive overexpression of PLM S68E on levels of selected proteins

	Wild-type	ConS68E
4 wk
NCX1	260.5 ± 9.2 (5)	244.1 ± 9.5 (4)
SERCA2	151.1 ± 5.5	101.3 ± 6.2^*
α₁, Na^-K^-ATPase	109.5 ± 11.9	101.4 ± 9.8
α₂, Na^-K^-ATPase	161.6 ± 5.9	161.4 ± 7.2
Ca_v1.2	111.1 ± 12.6	135.3 ± 2.5^*
RyR2	184.0 ± 14.3	192.5 ± 48.8
p-RyR2	160.2 ± 21.4	123.0 ± 17.3
Calsequestrin	380.2 ± 13.2	330.3 ± 31.0
22 wk
NCX1	223.4 ± 2.3 (5)	225.9 ± 6.9 (4)
SERCA2	526.2 ± 27.0	529.6 ± 43.1
α₁, Na^-K^-ATPase	218.0 ± 9.4	196.2 ± 5.8
α₂, Na^-K^-ATPase	91.8 ± 17.3	105.4 ± 22.3
Calsequestrin	465.9 ± 21.1	416.0 ± 39.6

^P < 0.02, wild-type versus conS68E.

Effects of constitutive overexpression of S68E mutant on action potential.

Fig. 5.

Effects of constitutive overexpression of S68E mutant on I_NaCa, I_pump, and I_Ca.

Fig. 6.

Fig. 7.

Fig. 8.

Effects of constitutive overexpression of S68E mutant on depolarization-activated K^currents.

Fig. 9.

Effects of constitutive overexpression of S68E mutant on [Ca^]_i transients, myocyte contractility, and [Na^]_i.

Table 4.

Effects of constitutive overexpression of PLM S68E on [Ca^]_i transients

Iso	Wild-type	conS68E
	Diastolic [Ca^]_i, nM
−	109.1 ± 6.3 (28)	122.6 ± 3.5⁽³⁷⁾
+	94.4 ± 8.3 (15)	112.9 ± 7.4⁽¹⁷⁾
	Systolic [Ca^]_i, nM
−	224.0 ± 11.3	234.4 ± 8.4
+	558.7 ± 45.0	462.5 ± 28.0^*
	[Ca^]_i transient amplitude, % increase in fura-2 signal
−	18.9 ± 1.1	17.7 ± 0.7^*
+	58.1 ± 3.9	46.4 ± 3.7^*
	t_1/2 of [Ca^]_i transient decline, ms
−	107 ± 4	130 ± 4^*
+	61 ± 2	73 ± 3^*

^P < 0.02, wild-type versus conS68E.

Fig. 10.

Fig. 11.

Transgenic mouse model constitutively overexpressing PLM S68E mutant.

Fig. 1.

Constitutive overexpression of S68E mutant resulted in early mortality.

Fig. 2.

Fig. 3.

Table 1.

Echocardiographic parameters of constitutively overexpressed PLM S68E mice

	Wild-type	ConS68E
4 wk
Body weight, g	18.8 ± 0.6 (14)	15.6 ± 0.8⁽¹²⁾
LV mass, mg	44.5 ± 2.2	53.6 ± 3.8⁺
Heart rate, beats/min	429 ± 12	204 ± 22^*
Ejection fraction, %	76.1 ± 1.5	89.5 ± 2.3^*
Fractional shortening, %	44.1 ± 1.4	61.1 ± 2.8^*
Stroke volume, μl	34.2 ± 1.6	51.4 ± 4.2^*
Cardiac output, ml/min	14.6 ± 0.7	10.3 ± 1.0^*
22 wk
Body weight, g	25.5 ± 0.5 (14)	27.0 ± 1.2 (7)
LV mass, mg	72.8 ± 2.2	92.8 ± 6.9^*
Heart rate, beats/min	458 ± 13	301 ± 38^*
Ejection fraction, %	71.9 ± 1.5	74.2 ± 2.6
Fractional shortening, %	40.6 ± 1.3	43.1 ± 2.2
Stroke volume, μl	40.9 ± 1.8	57.0 ± 4.5^*
Cardiac output, ml/min	18.5 ± 0.7	17.2 ± 2.4

Values are means ± SE for number of mice in parentheses. PLM, phospholemman; conS68E, transgenic mice constitutively overexpressing PLM S68E mutant; LV, left ventricle.

^P < 0.005; ^P < 0.05; wild-type vs. conS68E.

Table 2.

In vivo hemodynamics of constitutively overexpressed PLM S68E mice

	Wild-type	ConS68E
Heart rate, beats/min	415 ± 18 (7)	256 ± 28⁽⁷⁾
+dP/dt, mmHg/s	6,965 ± 432	6,519 ± 280
−dP/dt, mmHg/s	6,455 ± 492	5,922 ± 570
Maximal
Heart rate, beats/min	478 ± 11	327 ± 17^*
+dP/dt, mmHg/s	11,539 ± 721	9,197 ± 655^*
−dP/dt, mmHg/s	9,097 ± 571	7,913 ± 1,212^*

^P < 0.02, wild-type vs. conS68E.

Effects of constitutive overexpression of S68E mutant on expression of selected proteins involved in EC coupling.

Fig. 4.

Table 3.

Effects of constitutive overexpression of PLM S68E on levels of selected proteins

	Wild-type	ConS68E
4 wk
NCX1	260.5 ± 9.2 (5)	244.1 ± 9.5 (4)
SERCA2	151.1 ± 5.5	101.3 ± 6.2^*
α₁, Na^-K^-ATPase	109.5 ± 11.9	101.4 ± 9.8
α₂, Na^-K^-ATPase	161.6 ± 5.9	161.4 ± 7.2
Ca_v1.2	111.1 ± 12.6	135.3 ± 2.5^*
RyR2	184.0 ± 14.3	192.5 ± 48.8
p-RyR2	160.2 ± 21.4	123.0 ± 17.3
Calsequestrin	380.2 ± 13.2	330.3 ± 31.0
22 wk
NCX1	223.4 ± 2.3 (5)	225.9 ± 6.9 (4)
SERCA2	526.2 ± 27.0	529.6 ± 43.1
α₁, Na^-K^-ATPase	218.0 ± 9.4	196.2 ± 5.8
α₂, Na^-K^-ATPase	91.8 ± 17.3	105.4 ± 22.3
Calsequestrin	465.9 ± 21.1	416.0 ± 39.6

^P < 0.02, wild-type versus conS68E.

Effects of constitutive overexpression of S68E mutant on action potential.

Fig. 5.

Effects of constitutive overexpression of S68E mutant on I_NaCa, I_pump, and I_Ca.

Fig. 6.

Fig. 7.

Fig. 8.

Effects of constitutive overexpression of S68E mutant on depolarization-activated K^currents.

Fig. 9.

Effects of constitutive overexpression of S68E mutant on [Ca^]_i transients, myocyte contractility, and [Na^]_i.

Table 4.

Effects of constitutive overexpression of PLM S68E on [Ca^]_i transients

Iso	Wild-type	conS68E
	Diastolic [Ca^]_i, nM
−	109.1 ± 6.3 (28)	122.6 ± 3.5⁽³⁷⁾
+	94.4 ± 8.3 (15)	112.9 ± 7.4⁽¹⁷⁾
	Systolic [Ca^]_i, nM
−	224.0 ± 11.3	234.4 ± 8.4
+	558.7 ± 45.0	462.5 ± 28.0^*
	[Ca^]_i transient amplitude, % increase in fura-2 signal
−	18.9 ± 1.1	17.7 ± 0.7^*
+	58.1 ± 3.9	46.4 ± 3.7^*
	t_1/2 of [Ca^]_i transient decline, ms
−	107 ± 4	130 ± 4^*
+	61 ± 2	73 ± 3^*

^P < 0.02, wild-type versus conS68E.

Fig. 10.

Fig. 11.

DISCUSSION

This is the first report in which the sensitivity of C2 antibody was systematically compared among heart tissues obtained from dog, rat, and mice of two different genetic backgrounds (C57BL/6 and FVB). The COOH terminus of PLM is identical among dog, rat, human, and rabbit but Thr^{is replaced with serine in mouse PLM (}30). In addition, although C2 preferentially recognizes unphosphorylated PLM (21), there is cross-reactivity with PLM phosphorylated at Ser^{. We were careful to dephosphorylate the 25–40% of endogenous heart PLM that is phosphorylated (}11, 25, 27, 43) before probing with C2. With the assumption that expression of PLM is similar among dog, rat, and FVB mouse LV, the sensitivity of C2 in terms of detecting dog, rat, and FVB mouse PLM was 1:1:0.75, respectively.

The first major finding is that with constitutive S68E overexpression, >50% of mice suffered early mortality from arrhythmias or heart failure. In young conS68E mice, severe bradycardia was accompanied by increased LV mass and reduced CO. In contrast with virus-mediated expression of S68E mutant in adult mouse LV myocytes in which only Na^/Ca^{exchanger activity was suppressed (}29, 35), in myocytes constitutively overexpressing S68E mutant a myriad of cellular changes commonly found in heart failure was observed. To wit, prolongation of action potential (48), reduced SERCA2 expression and SR Ca^{uptake (}44), decreased Na^-K^{-ATPase activity (}10), decreased I_to (48), blunted β-adrenergic response (42), elevated diastolic [Ca^]_i and lower systolic [Ca^]_i, and decreased single myocyte contractility have all been described in various models of heart failure (12). Thus the failure of I_pump to meaningfully increase in Iso-stimulated conS68E myocytes and reduced inotropic, chronotropic, and lusitropic responses in Iso-treated conS68E hearts may all be consequences of uncoupling of β-adrenergic receptor commonly observed in heart failure.

The mechanism by which constitutive overexpression of S68E mutant resulted in arrhythmias and early death was not addressed in the present study. Severe prolongation of APD may provide the cellular substrate for cardiac arrhythmias. Prolongation of APD in conS68E myocytes is likely due to decreased I_to,f and I_K,slow, and both currents are important in repolarization. Reduced I_NaCa in conS68E myocytes would be expected to shorten APD (33–35). Similarly, decreased I_Ca with no changes in inactivation time constants in conS68E myocytes would also be expected to shorten APD.

Another mechanism that is known to promote arrhythmias is elevation of diastolic [Ca^]_i. In conS68E myocytes, elevated diastolic [Ca^]_i was likely due to decreased SERCA2 expression and SR Ca^{uptake activity, reduced Ca}^{extrusion due to NCX1 inhibition, and decreased}I_pump. Increased SR Ca^{leak was less likely since both total and phosphorylated RyR2 remained unchanged in conS68E hearts. Elevated diastolic [Ca}^]_i would favor Ca^{extrusion via Na}^/Ca^{exchanger during diastole, giving rise to transient inward current, delayed after-depolarization, and arrhythmogenesis. This mechanism, although attractive, is less likely to account for bradycardia and ventricular arrhythmias in conS68E mice since NCX1 is inhibited, albeit modestly.}

Severe prolongation of APD may be a consequence of heart failure rather than specifically related to S68E overexpression. It would be interesting to examine whether S68E overexpression affected pacemaker activity in sinoatrial and atrioventricular nodes or conduction defects resulting in re-entry arrhythmias. In this light, it is interesting to note that mice with atrial-specific NCX1 knockout exhibited bradycardia (heart rate decreased from ∼525 beats/min in WT to ∼350 beats/min in atrial-specific NCX1 knockout mice; Ken Philipson, personal communications). Our observations of severe bradycardia in conS68E hearts (S68E was also expressed in the atria), together with the preliminary results on atrial-specific NCX1-KO mice, suggest that NCX1 is critical in regulation of the rhythmic calcium clock in pacemaker cells.

Because NCX1 regulates both Ca^{influx and efflux in an EC cycle, alterations in its expression or activity would theoretically impact on myocyte contractile behavior and Ca}^{homeostasis. Focusing on adult LV myocytes, overexpression of NCX1 by adenoviral-mediated gene transfer decreases myocyte contraction and SR Ca}^{content in adult rabbit (}20, 24) but not rat ventricular myocytes (46). This is likely due to species differences in [Na^]_i and action potential morphology. In 4-mo-old heterozygous TG mice constitutively overexpressing dog NCX1, baseline LV function (+dP/dt, −dP/dt, and LVED diameter) is similar to WT mice (22). At the cellular level, systolic and diastolic [Ca^]_i, [Ca^]_i transient amplitude, and SR Ca^{content are not different between WT and heterozygous TG myocytes despite an estimated 1.5-fold to threefold higher NCX1 activity (}1, 32, 40). In 10-wk-old mice in which rat NCX1 TG expression is induced to be 2.5-fold higher than endogenous NCX1 present in mouse, there are no differences in CO, systolic and diastolic [Ca^]_i, [Ca^]_i transient amplitude, and SR Ca^{content measured at physiological [Ca}^]_o (34). Therefore, cumulative evidence suggests little to no effect on cardiac and myocyte contractility, [Ca^]_i homeostasis, and animal survival with modest increase in NCX1 activity. On the other hand, cardiac-specific knockout of NCX1 results in modest diminution of global LV function (21–35%), with no detectable changes in diastolic [Ca^]_i, [Ca^]_i transient amplitude, and SR Ca^{content despite >90% elimination of NCX1 expression or activity (}14). Similarly, NCX1 downregulation by anti-sense in adult rat LV myocytes (∼30% knockdown) has little effect on myocyte contractility, systolic and diastolic [Ca^]_i, and [Ca^]_i transient amplitudes measured at physiological [Ca^]_o (31). Therefore, it was surprising that the modest inhibition of NCX1 activity (∼34%) by constitutively overexpressing phosphomimetic PLM would lead to such a catastrophic phenotype and suggests mechanisms in addition to inhibition of NCX1 may apply.

Another cardiac Ca^{transporter regulated by PLM is L-type Ca}^{channel (}38). It is conceivable that constitutive S68E overexpression decreased cardiac contractility by modulating I_Ca. Indeed, peak I_Ca amplitude was decreased and voltage at which maximal I_Ca occurred was right-shifted by ∼10 mV. Decrease in I_Ca was all the more remarkable when one considers that the protein level of α-subunit of L-type Ca^{channel was increased in conS68E myocytes.}

In many, but not all, models of heart failure including end-stage human cardiomyopathy, expression of NCX1 is increased (12, 26) and has been proposed to be the culprit for reduced cardiac contractility (24) and arrhythmogenesis (18, 19). Modulation of Na^/Ca^{exchanger expression or activity has been proposed as a therapeutic target in heart failure (}13, 16, 26). Although modest overexpression of NCX1, either constitutively (22) or induced (34) in the heterozygous transgenic mice, does not grossly affect LV size and function and life span, one interpretation of our current results suggests that inhibition of NCX1 (∼34%) by constitutively overexpression PLM S68E mutant is detrimental: both in terms of contractile dysfunction and early mortality. Our observations, together with those from Ken Philipson's group on the constitutive homozygous transgenic mouse overexpressing NCX1 TG (increased LV mass and LVED diameter, decreased survival under stressful conditions) (22), clearly indicate that the therapeutic window for manipulating NCX1 expression or function is very narrow.

There are limitations to the present study. The major one is that the ∼40-fold overexpression of S68E mutant may give rise to nonspecific effects causing arrhythmias and heart failure. High levels of transgenic expression of even seemingly innocuous proteins such as green fluorescent protein (15) or Cre-recombinase (5) can cause dilated cardiomyopathy. In addition, constitutive overexpression of S68E mutant resulted in reduction in baseline I_pump with no gross changes in expression of α₁- and α₂-subunits of Na^-K^{-ATPase in conS68E myocytes. This is unexpected and may relate to nonspecific effects of S68E mutant overexpression. The dilemma between specific (NCX1 inhibition) and nonspecific effects of S68E overexpression on arrhythmogenesis and heart failure may be resolved with induced expression of S68E mutant in which the level of expression of the mutant protein is likely to be lower and can be manipulated.}

In summary, we have engineered a novel mouse model in which the phosphomimetic phospholemman S68E mutant was overexpressed by ∼40 times compared with endogenous WT PLM. Constitutive overexpression of S68E, despite only having a modest (∼34%) inhibitory effect on Na^/Ca^{exchanger activity, resulted in arrhythmias, cardiac hypertrophy, reduced inotropy, and early mortality. In myocytes constitutively overexpressing S68E, a myriad of cellular changes commonly found in heart failure was observed. We conclude that overexpression of PLM S68E was detrimental. We caution that maneuvers aimed at modulating NCX1 activity in disease states may have a very narrow therapeutic window.}

GRANTS

This work was supported in part by National Heart, Lung, and Blood Institute Grants RO1-HL-58672 and RO1-HL-74854 (to J. Y. Cheung), RO1-HL-56205, RO1-HL-61690, RO1-HL-85503, PO1-HL-75443, and PO1-HL-91799 (to W. J. Koch), and PO1-HL-91799 (Project 2; to A. M. Feldman); the Pennsylvania Research Formulary Fund (to A. M. Feldman); and by an American Heart Association Scientist Development Grant F64702 (to T. O. Chan).

DISCLOSURES

No conflicts of interest, financial or otherwise, are declared by the author(s).

AUTHOR CONTRIBUTIONS

Author contributions: J.S., E.G., J.W., X.-Q.Z., T.O.C., W.J.K., X.S., J.I.J., and J.Y.C. performed experiments; J.S., E.G., J.W., X.-Q.Z., X.S., J.I.J., B.Z.P., A.M.F., and J.Y.C. analyzed data; J.S., E.G., J.W., X.-Q.Z., T.O.C., W.J.K., X.S., J.I.J., B.Z.P., A.M.F., and J.Y.C. interpreted results of experiments; J.S., J.W., X.-Q.Z., and J.Y.C. prepared figures; J.S., E.G., J.W., X.-Q.Z., T.O.C., W.J.K., X.S., J.I.J., B.Z.P., A.M.F., and J.Y.C. approved final version of manuscript; J.W., T.O.C., A.M.F., and J.Y.C. edited and revised manuscript; J.Y.C. conception and design of research; J.Y.C. drafted manuscript.

^{Division of Nephrology,}

^{Center of Translational Medicine, Department of Medicine,}

^{Department of Anesthesiology, Jefferson Medical College, Thomas Jefferson University, Philadelphia; and}

^{Department of Cellular and Molecular Physiology, Pennsylvania State University College of Medicine, Hershey, Pennsylvania}

^{Corresponding author.}

^{J. Song and E. Gao contributed equally to this work.}

Address for reprint requests and other correspondence: J. Y. Cheung, Division of Nephrology, Thomas Jefferson Univ., 833 Chestnut St., Suite 700, Philadelphia, PA 19107 (e-mail: ude.nosreffej@gnuehc.hpesoj).

Received 2011 Jul 22; Accepted 2011 Nov 7.

Abstract

Expression and activity of cardiac Na^/Ca^{exchanger (NCX1) are altered in many disease states. We engineered mice in which the phosphomimetic phospholemman S68E mutant (inhibits NCX1 but not Na}^-K^{-ATPase) was constitutively overexpressed in a cardiac-specific manner (conS68E). At 4–6 wk, conS68E mice exhibited severe bradycardia, ventricular arrhythmias, increased left ventricular (LV) mass, decreased cardiac output (CO), and ∼50% mortality compared with wild-type (WT) littermates. Protein levels of NCX1, calsequestrin, ryanodine receptor, and α}₁- and α₂-subunits of Na^-K^{-ATPase were similar, but sarco(endo)plasmic reticulum Ca}^{-ATPase was lower, whereas L-type Ca}^{channels were higher in conS68E hearts. Resting membrane potential and action potential amplitude were similar, but action potential duration was dramatically prolonged in conS68E myocytes. Diastolic intracellular Ca}^([Ca^]_i) was higher, [Ca^]_i transient and maximal contraction amplitudes were lower, and half-time of [Ca^]_i transient decline was longer in conS68E myocytes. Intracellular Na^{reached maximum within 3 min after isoproterenol addition, followed by decline in WT but not in conS68E myocytes. Na}^/Ca^{exchange, L-type Ca}^{, Na}^-K^{-ATPase, and depolarization-activated K}^{currents were decreased in conS68E myocytes. At 22 wk, bradycardia and increased LV mass persisted in conS68E survivors. Despite comparable baseline CO, conS68E survivors at 22 wk exhibited decreased chronotropic, inotropic, and lusitropic responses to isoproterenol. We conclude that constitutive overexpression of S68E mutant was detrimental, both in terms of depressed cardiac function and increased arrhythmogenesis.}

Keywords: intracellular Ca^{and Na}^{regulation, in vivo catheterization, β-adrenergic responsiveness, FXYD proteins}

Abstract

the cardiac na^/ca^exchanger (NCX1) occupies a key role in excitation-contraction (EC) coupling (3). During diastole, NCX1 primarily functions in the Ca^{efflux (3 Na}^{in: 1 Ca}^{out) mode. During systole, when the membrane potential (}E_m) exceeds the equilibrium potential of NCX1 (E_NaCa), Ca^{influx (3 Na}^{out: 1 Ca}^{in) is thermodynamically favored. Alteration in expression or function in NCX1 in disease states would theoretically affect intracellular Na}^([Na^]_i) and Ca^([Ca^]_i) homeostasis, with major impact on cardiac EC coupling. Unequivocal support for the hypothesis that altered NCX1 function or expression, by itself, is the major culprit for contractile abnormalities in heart failure has remained elusive. First, heart failure is associated with a myriad of changes in proteins involved in EC coupling (12) and it is difficult to unambiguously assign contractile dysfunction to one particular ion transporter. Second, whether expression or activity of NCX1 is increased or decreased depends on the heart failure model and species studied (7, 26). Third, heart failure did not occur when NCX1 transgene (TG) was induced to be expressed in adult mice at levels found in diseased hearts (34). Fourth, cardiac-specific knockout of NCX1 resulted only in modest (20% to 30%) reduction of contractility at 7.5 wk of age (14).

Although NCX1 is a key ion transporter in the heart, remarkably little is known about its functional regulation (4, 9, 17). Phospholemman (PLM), the founding member of the FXYD family of small ion transport regulators (30), is the first reported endogenous protein regulator of NCX1 (2, 6, 45). PLM associates with NCX1 in cardiac membranes (2, 38) and regulates NCX1 transport activity by interacting with the proximal linker domain of the intracellular loop of NCX1 (37, 47). When phosphorylated at Ser^{, PLM inhibits NCX1 activity (}41) while simultaneously relieving its inhibition on Na^-K^{-ATPase (}8, 25, 36). Mutating Ser^{in PLM to glutamic acid (S68E mutant) resulted in inhibition of NCX1 without any effects on Na}^-K^{-ATPase activity in adult cardiac myocytes (}29, 35). Using a novel TG mouse model in which S68E mutant was constitutively overexpressed in the heart, we tested the hypothesis that inhibition of NCX1 by constitutive overexpression of S68E mutant resulted in profound alterations in [Ca^]_i and [Na^]_i regulation, leading to contractile failure and arrhythmogenesis.

Values are means ± SE for number of mice in parentheses. PLM, phospholemman; conS68E, transgenic mice constitutively overexpressing PLM S68E mutant; LV, left ventricle.

REFERENCES

References

1. Adachi-Akahane S, Lu L, Li Z, Frank JS, Philipson KD, Morad M. Calcium signaling in transgenic mice overexpressing cardiac Na^-Ca^exchanger. J Gen Physiol109: 717–729, 1997
2. Ahlers BA, Zhang XQ, Moorman JR, Rothblum LI, Carl LL, Song J, Wang J, Geddis LM, Tucker AL, Mounsey JP, Cheung JY. Identification of an endogenous inhibitor of the cardiac Na^/Ca^{exchanger, phospholemman}. J Biol Chem280: 19875–19882, 2005 [[PubMed]
3. Bers DM. Cardiac Na/Ca exchange function in rabbit, mouse and man: what's the difference?J Mol Cell Cardiol34: 369–373, 2002 [[PubMed]
4. Blaustein M, Lederer W. Sodium/calcium exchange: its physiological implications. Physiol Rev79: 763–854, 1999 [[PubMed]
5. Buerger A, Rozhitskaya O, Sherwood MC, Dorfman AL, Bisping E, Abel ED, Pu WT, Izumo S, Jay PY. Dilated cardiomyopathy resulting from high-level myocardial expression of Cre-recombinase. J Card Fail12: 392–398, 2006 [[PubMed]
6. Cheung JY, Rothblum LI, Moorman JR, Tucker AL, Song J, Ahlers BA, Carl LL, Wang J, Zhang XQ. Regulation of cardiac Na^/Ca^{exchanger by phospholemman}. Ann NY Acad Sci1099: 119–134, 2007 [[PubMed]
7. Cheung JY, Song J, Rothblum LI, Zhang XQ. Exercise training improves cardiac function postinfarction: special emphasis on recent controversies on Na^/Ca^exchanger. Exerc Sport Sci Rev32: 83–89, 2004 [[PubMed]
8. Despa S, Bossuyt J, Han F, Ginsburg KS, Jia LG, Kutchai H, Tucker AL, Bers DM. Phospholemman-phosphorylation mediates the β-adrenergic effects on Na/K pump function in cardiac myocytes. Circ Res97: 252–259, 2005 [[PubMed]
9. DiPolo R, Beauge L. Sodium/calcium exchanger: influence of metabolic regulation on ion carrier interactions. Physiol Rev86: 155–203, 2006 [[PubMed]
10. Dixon IMC, Hata T, Dhalla NS. Sarcolemmal Na^-K^{-ATPase activity in congestive heart failure due to myocardial infarction}. Am J Physiol Cell Physiol262: C664–C671, 1992 [[PubMed]
11. Fuller W, Howie J, McLatchie L, Weber R, Hastie CJ, Burness K, Pavlovic D, Shattock MJ. FXYD1 phosphorylation in vitro and in adult rat cardiac myocytes: threonine69 is a novel substrate for protein kinase C. Am J Physiol Cell Physiol296: C1346–C1355, 2009
12. Hasenfuss G. Alteration of calcium-regulatory proteins in heart failure. Cardiovasc Res37: 279–289, 1998 [[PubMed]
13. Hasenfuss G, Schillinger W. Is modulation of sodium-calcium exchange a therapeutic option in heart failure?Circ Res95: 225–227, 2004 [[PubMed]
14. Henderson SA, Goldhaber JI, So JM, Han T, Motter C, Ngo A, Chantawansri C, Ritter MR, Friedlander M, Nicoll DA, Frank JS, Jordan MC, Roos KP, Ross RS, Philipson KD. Functional adult myocardium in the absence of Na^-Ca^{exchange: cardiac-specific knockout of NCX1}. Circ Res95: 604–611, 2004 [[PubMed]
15. Huang WY, Aramburu J, Douglas PS, Izumo S. Transgenic expression of green fluorescence protein can cause dilated cardiomyopathy. Nat Med6: 482–483, 2000 [[PubMed]
16. Litwin S, Bridge JH. Enhanced Na^-Ca^{exchange in the infarcted heart. Implications for excitation-contraction coupling}. Circ Res81: 1083–1093, 1997 [[PubMed]
17. Philipson KD, Nicoll DA. Sodium-calcium exchange: a molecular perspective. Annu Rev Physiol62: 111–133, 2000 [[PubMed]
18. Pogwizd SM, Qi M, Yuan W, Samarel AM, Bers DM. Upregulation of Na^/Ca^{exchanger expression and function in an arrhythmogenic rabbit model of heart failure}. Circ Res85: 1009–1019, 1999 [[PubMed]
19. Pogwizd SM, Schlotthauer K, Li L, Yuan W, Bers DM. Arrhythmogenesis and contractile dysfunction in heart failure: roles of sodium-calcium exchange, inward rectifier potassium current, and residual β-adrenergic responsiveness. Circ Res88: 1159–1167, 2001 [[PubMed]
20. Ranu HK, Terracciano CM, Davia K, Bernobich E, Chaudhri B, Robinson SE, Bin Kang Z, Hajjar RJ, MacLeod KT, Harding SE. Effects of Na^/Ca^{exchanger overexpression on excitation-contraction coupling in adult rabbit ventricular myocytes}. J Mol Cell Cardiol34: 389–400, 2002 [[PubMed]
21. Rembold CM, Ripley ML, Meeks MK, Geddis LM, Kutchai HC, Marassi FM, Cheung JY, Moorman JR. Serine68 phospholemman phosphorylation during forskolin-induced swine carotid artery relaxation. J Vasc Res42: 483–491, 2005
22. Roos KP, Jordan MC, Fishbein MC, Ritter MR, Friedlander M, Chang HC, Rahgozar P, Han T, Garcia AJ, Maclellan WR, Ross RS, Philipson KD. Hypertrophy and heart failure in mice overexpressing the cardiac sodium-calcium exchanger. J Card Fail13: 318–329, 2007
23. Sanbe A, Gulick J, Hanks MC, Liang Q, Osinska H, Robbins J. Reengineering inducible cardiac-specific transgenesis with an attenuated myosin heavy chain promoter. Circ Res92: 609–616, 2003 [[PubMed]
24. Schillinger W, Janssen PM, Emami S, Henderson SA, Ross RS, Teucher N, Zeitz O, Philipson KD, Prestle J, Hasenfuss G. Impaired contractile performance of cultured rabbit ventricular myocytes after adenoviral gene transfer of Na^-Ca^exchanger. Circ Res87: 581–587, 2000 [[PubMed]
25. Silverman BD, Fuller W, Eaton P, Deng J, Moorman JR, Cheung JY, James AF, Shattock MJ. Serine68 phosphorylation of phospholemman: acute isoform-specific activation of cardiac Na/K ATPase. Cardiovasc Res65: 93–103, 2005 [[PubMed]
26. Sipido KR, Volders PGA, Vos MA, Verdonck F. Altered Na/Ca exchange activity in cardiac hypertrophy and heart failure: a new target for therapy?Cardiovasc Res53: 782–805, 2002 [[PubMed]
27. Song J, Zhang XQ, Ahlers BA, Carl LL, Wang J, Rothblum LI, Stahl RC, Mounsey JP, Tucker AL, Moorman JR, Cheung JY. Serine68 of phospholemman is critical in modulation of contractility, [Ca_i transients, and Na^/Ca^{exchange in adult rat cardiac myocytes}. Am J Physiol Heart Circ Physiol288: H2342–H2354, 2005 [[PubMed]
28. Song J, Zhang XQ, Carl LL, Qureshi A, Rothblum LI, Cheung JY. Overexpression of phospholemman alter contractility and [Ca_i transients in adult rat myocytes. Am J Physiol Heart Circ Physiol283: H576–H583, 2002 [[PubMed]
29. Song J, Zhang XQ, Wang J, Cheskis E, Chan TO, Feldman AM, Tucker AL, Cheung JY. Regulation of cardiac myocyte contractility by phospholemman: Na^/Ca^{exchange vs. Na}^-K^-ATPase. Am J Physiol Heart Circ Physiol295: H1615–H1625, 2008
30. Sweadner KJ, Rael E. The FXYD gene family of small ion transport regulators or channels: cDNA sequence, protein signature sequence, and expression. Genomics68: 41–56, 2000 [[PubMed]
31. Tadros GM, Zhang XQ, Song J, Carl LL, Rothblum LI, Tian Q, Dunn J, Lytton J, Cheung JY. Effects of Na^/Ca^{exchanger downregulation on contractility and [Ca}_i transients in adult rat myocytes. Am J Physiol Heart Circ Physiol283: H1616–H1626, 2002 [[PubMed]
32. Terracciano CMN, DeSouza AI, Philipson KD, MacLeod KT. Na^-Ca^{exchange and sarcoplasmic reticular Ca}^{regulation in ventricular myocytes from transgenic mice overexpression the Na}^-Ca^exchanger. J Physiol512: 651–667, 1998
33. Tucker AL, Song J, Zhang XQ, Wang J, Ahlers BA, Carl LL, Mounsey JP, Moorman JR, Rothblum LI, Cheung JY. Altered contractility and [Ca_i homeostasis in phospholemman-deficient murine myocytes: role of Na^/Ca^exchange. Am J Physiol Heart Circ Physiol291: H2199–H2209, 2006
34. Wang J, Chan TO, Zhang XQ, Gao E, Song J, Koch WJ, Feldman AM, Cheung JY. Induced overexpression of Na^/Ca^{exchanger transgene: altered myocyte contractility, [Ca}_i transients, SR Ca^{contents and action potential duration}. Am J Physiol Heart Circ Physiol297: H590–H601, 2009
35. Wang J, Gao E, Rabinowitz J, Song J, Zhang XQ, Koch WJ, Tucker AL, Chan TO, Feldman AM, Cheung JY. Regulation of in vivo cardiac contractility by phospholemman: role of Na^/Ca^exchange. Am J Physiol Heart Circ Physiol300: H859–H868, 2011
36. Wang J, Gao E, Song J, Zhang XQ, Li J, Koch WJ, Tucker AL, Philipson KD, Chan TO, Feldman AM, Cheung JY. Phospholemman and β-adrenergic stimulation in the heart. Am J Physiol Heart Circ Physiol298: H807–H815, 2010
37. Wang J, Zhang XQ, Ahlers BA, Carl LL, Song J, Rothblum LI, Stahl RC, Carey DJ, Cheung JY. Cytoplasmic tail of phospholemman interacts with the intracellular loop of the cardiac Na^/Ca^exchanger. J Biol Chem281: 32004–32014, 2006
38. Wang X, Gao G, Guo K, Yarotskyy V, Huang C, Elmslie KS, Peterson BZ. Phospholemman modulates the gating of cardiac L-type calcium channels. Biophys J98: 1149–1159, 2010
39. Xu H, Guo W, Nerbonne JM. Four kinetically distinct depolarization-activated K^{currents in adult mouse ventricular myocytes}. J Gen Physiol113: 661–678, 1999
40. Yao A, Su Z, Nonaka A, Zubair I, Lu L, Philipson KD, Bridge JHB, Barry WH. Effects of overexpression of the Na^-Ca^{exchanger on [Ca}_i transients in murine ventricular myocytes. Circ Res82: 657–665, 1998 [[PubMed]
41. Zhang XQ, Ahlers BA, Tucker AL, Song J, Wang J, Moorman JR, Mounsey JP, Carl LL, Rothblum LI, Cheung JY. Phospholemman inhibition of the cardiac Na^/Ca^{exchanger. Role of phosphorylation}. J Biol Chem281: 7784–7792, 2006
42. Zhang XQ, Moore RL, Tillotson DL, Cheung JY. Calcium currents in postinfarction rat cardiac myocytes. Am J Physiol Cell Physiol269: C1464–C1473, 1995 [[PubMed]
43. Zhang XQ, Moorman JR, Ahlers BA, Carl LL, Lake DE, Song J, Mounsey JP, Tucker AL, Chan YM, Rothblum LI, Stahl RC, Carey DJ, Cheung JY. Phospholemman overexpression inhibits Na^-K^{-ATPase in adult rat cardiac myocytes: relevance to decreased Na}^{pump activity in post-infarction myocytes}. J Appl Physiol100: 212–220, 2006
44. Zhang XQ, Ng YC, Moore RL, Musch TI, Cheung JY. In situ SR function in postinfarction myocytes. J Appl Physiol87: 2143–2150, 1999 [[PubMed]
45. Zhang XQ, Qureshi A, Song J, Carl LL, Tian Q, Stahl RC, Carey DJ, Rothblum LI, Cheung JY. Phospholemman modulates Na^/Ca^{exchange in adult rat cardiac myocytes}. Am J Physiol Heart Circ Physiol284: H225–H233, 2003 [[PubMed]
46. Zhang XQ, Song J, Rothblum LI, Lun M, Wang X, Ding F, Dunn J, Lytton J, McDermott PJ, Cheung JY. Overexpression of Na^/Ca^{exchanger alters contractility and SR Ca}^{content in adult rat myocytes}. Am J Physiol Heart Circ Physiol281: H2079–H2088, 2001 [[PubMed]
47. Zhang XQ, Wang J, Carl LL, Song J, Ahlers BA, Cheung JY. Phospholemman regulates cardiac Na^/Ca^{exchanger by interacting with the exchanger's proximal linker domain}. Am J Physiol Cell Physiol296: C911–C921, 2009
48. Zhang XQ, Zhang LQ, Palmer BM, Ng YC, Musch TI, Moore RL, Cheung JY. Sprint training shortens prolonged action potential duration in postinfarction rat myocyte: mechanisms. J Appl Physiol90: 1720–1728, 2001 [[PubMed]
49. Zhou YY, Wang SQ, Zhu WZ, Chruscinski A, Kobilka BK, Ziman B, Wang S, Lakatta EG, Cheng H, Xiao RP. Culture and adenoviral infection of adult mouse cardiac myocytes: methods for cellular genetic physiology. Am J Physiol Heart Circ Physiol279: H429–H436, 2000 [[PubMed]

Constitutive overexpression of phosphomimetic phospholemman S68E mutant results in arrhythmias, early mortality, and heart failure: potential involvement of Na<sup>+</sup>/Ca<sup>2+</sup> exchanger

METHODS

Generation of PLM S68E TG mouse.

Echocardiographic and hemodynamic analyses of cardiac function.

Isolation of adult murine cardiac myocytes.

Myocyte shortening measurements.

[Ca]i transient measurements.

[Na]i measurements.

Electrophysiological measurements.

Immunoblotting.

Statistics.

Generation of PLM S68E TG mouse.

Echocardiographic and hemodynamic analyses of cardiac function.

Isolation of adult murine cardiac myocytes.

Myocyte shortening measurements.

[Ca]i transient measurements.

[Na]i measurements.

Electrophysiological measurements.

Immunoblotting.

Statistics.

Generation of PLM S68E TG mouse.

Echocardiographic and hemodynamic analyses of cardiac function.

Isolation of adult murine cardiac myocytes.

Myocyte shortening measurements.

[Ca]i transient measurements.

[Na]i measurements.

Electrophysiological measurements.

Immunoblotting.

Statistics.

RESULTS

Transgenic mouse model constitutively overexpressing PLM S68E mutant.

Constitutive overexpression of S68E mutant resulted in early mortality.

Table 1.

Table 2.

Effects of constitutive overexpression of S68E mutant on expression of selected proteins involved in EC coupling.

Table 3.

Effects of constitutive overexpression of S68E mutant on action potential.

Effects of constitutive overexpression of S68E mutant on INaCa, Ipump, and ICa.

Effects of constitutive overexpression of S68E mutant on depolarization-activated K currents.

Effects of constitutive overexpression of S68E mutant on [Ca]i transients, myocyte contractility, and [Na]i.

Table 4.

Transgenic mouse model constitutively overexpressing PLM S68E mutant.

Constitutive overexpression of S68E mutant resulted in early mortality.

Table 1.

Table 2.

Effects of constitutive overexpression of S68E mutant on expression of selected proteins involved in EC coupling.

Table 3.

Effects of constitutive overexpression of S68E mutant on action potential.

Effects of constitutive overexpression of S68E mutant on INaCa, Ipump, and ICa.

Effects of constitutive overexpression of S68E mutant on depolarization-activated K currents.

Effects of constitutive overexpression of S68E mutant on [Ca]i transients, myocyte contractility, and [Na]i.

Table 4.

Transgenic mouse model constitutively overexpressing PLM S68E mutant.

Constitutive overexpression of S68E mutant resulted in early mortality.

Table 1.

Table 2.

Effects of constitutive overexpression of S68E mutant on expression of selected proteins involved in EC coupling.

Table 3.

Effects of constitutive overexpression of S68E mutant on action potential.

Effects of constitutive overexpression of S68E mutant on INaCa, Ipump, and ICa.

Effects of constitutive overexpression of S68E mutant on depolarization-activated K currents.

Effects of constitutive overexpression of S68E mutant on [Ca]i transients, myocyte contractility, and [Na]i.

Table 4.

DISCUSSION

GRANTS

DISCLOSURES

AUTHOR CONTRIBUTIONS

Abstract

REFERENCES

References

[Ca^]_i transient measurements.

[Na^]_i measurements.

[Ca^]_i transient measurements.

[Na^]_i measurements.

[Ca^]_i transient measurements.

[Na^]_i measurements.

Effects of constitutive overexpression of S68E mutant on I_NaCa, I_pump, and I_Ca.

Effects of constitutive overexpression of S68E mutant on depolarization-activated K^currents.

Effects of constitutive overexpression of S68E mutant on [Ca^]_i transients, myocyte contractility, and [Na^]_i.

Effects of constitutive overexpression of S68E mutant on I_NaCa, I_pump, and I_Ca.

Effects of constitutive overexpression of S68E mutant on depolarization-activated K^currents.

Effects of constitutive overexpression of S68E mutant on [Ca^]_i transients, myocyte contractility, and [Na^]_i.

Effects of constitutive overexpression of S68E mutant on I_NaCa, I_pump, and I_Ca.

Effects of constitutive overexpression of S68E mutant on depolarization-activated K^currents.

Effects of constitutive overexpression of S68E mutant on [Ca^]_i transients, myocyte contractility, and [Na^]_i.