Impact of obesity on 7,12-dimethylbenz[a]anthracene-induced altered ovarian connexin gap junction proteins in female mice
Introduction
The ovary is the major female reproductive organ composed of follicles at different developmental stages from primordial to antral. Follicles contain a single oocyte, arrested in the diplotene stage of meiosis, which are surrounded by single to multiple layers of granulosa cells dependent on the stage of development. Granulosa cells are the somatic follicular cells and their functions include production of sex steroid hormones and growth factors which are essential for fertile reproductive life of women. Granulosa cell death by apoptosis is reportedly involved in the process of follicular atresia in the mammalian ovary (Tilly, 1997; Jiang et al., 2003).
Connexins (CX) are a family of transmembrane proteins that connect to form gap junctions; channels which allow direct exchange of ions and small molecules between adjacent cells and which are involved in cell proliferation, differentiation, cell survival, oocyte maturation, meiotic resumption and death (Gershon et al., 2008; Conti et al., 2012; Kar et al., 2012). Eight CX proteins are expressed in ovaries encoded by the Cx26, Cx30.3, Cx32, Cx37, Cx40, Cx43, Cx45 and Cx57 genes (Grazul-Bilska et al., 1997; Kidder and Mhawi, 2002). The most abundant CX protein expressed in mouse ovaries are CX37, CX43 and CX45 (Simon et al., 1997; Ackert et al., 2001; Wright et al., 2001). CX37 is present between the oocyte and granulosa cell (Simon et al., 1997) while CX43 (Valdimarsson et al., 1993; Gittens, 2003) and CX45 (Okuma et al., 1996; Alcoléa et al., 1999; Wright et al., 2001) co-localize between granulosa cells. CX proteins are expressed in a temporal pattern during follicular development and maturation in mouse ovaries (Wright et al., 2001), and defects in oocyte and follicular development have been identified in CX37 deficient mice in which heterologous oocyte-granulosa cell gap junctions were under developed (Carabatsos et al., 2000). Cx37-null mouse oocytes suffer growth retardation and do not survive to become meiotically competent (Carabatsos et al., 2000) due to lack of nutrient intake (Eppig, 1991). CX43 protein expression was also reduced in ovarian granulosa cells during follicular atresia in pigs and swamp buffaloes (Cheng et al., 2005; Feranil et al., 2005). Folliculogenesis and oocyte growth are impaired past the primary stage in Cx43-deficient mice (Juneja et al., 1999; Ackert et al., 2001). These studies indicate that CX proteins are important for completion of oocyte growth, acquisition of cytoplasmic meiotic competence and follicular survivability.
CX proteins are targeted by chemicals including retinoids, carotinoids, chemotherapeutic agents (Trosko and Ruch, 2002); Upham and Trosko, 2009; King and Bertram, 2005), cigarette components (Upham et al., 1996; Tai et al., 2007; Upham et al., 2008; Upham and Trosko, 2009); McKarns et al., 2000) and polycyclic aromatic hydrocarbons including 7,12-dimethylbenz[a]anthracene (DMBA) (Sharovskaya et al., 2006; Ganesan and Keating, 2014; (Trosko, 1989). DMBA, liberated from burning of organic matter incineration, destroys all type of follicles in the ovaries of exposed mice and rats, leading to ovarian failure (Gelboin, 1980; Mattison and Schulman, 1980). Cigarette smoke causes premature menopause onset in female smokers compared to their age matched non-smoking counterparts (Mattison et al., 1983; Alcoléa et al., 1999; Harlow and Signorello, 2000) and the offspring of female smokers have decreased numbers of oocytes, potentially leading to infertility (Jurisicova et al., 2007). DMBA destroys follicles by inducing apoptosis through increased expression of pro-apoptotic BAX and activation of the executioner protein caspase 3 (Tilly et al., 1991; Tsai-Turton et al., 2007). Additionally, DMBA altered CX protein expression when neonatal cultured rat ovaries were exposed in vitro (Ganesan and Keating, 2014).
Approximately one-third of adults in the USA are obese (Flegal Km et al., 2010; Meeker et al., 2010), and negative female phenotypic associations include polycystic ovarian syndrome, menstrual disorders, intrauterine fetal death and infertility (Haslam and James; Cardozo et al., 2012). Obesity also detrimentally affects pregnancy rates in natural and assisted conception potentially by reducing oocyte quality (Wu et al., 2011). Primordial and small primary follicle number were reduced in ovaries from obese mice with a concomitant increase in the number of secondary and pre-ovulatory follicles relative to lean mouse ovaries (Nteeba et al., 2014a). Additionally, ovaries from mice fed a high fat diet showed increased accumulation of endoplasmic reticulum stress, decreased mitochondrial activity and increased apoptosis of cumulus oocyte complexes and ovarian cells (Wu et al., 2010). Interestingly, a high fat diet also reduced cardiovascular Cx expression in female rats resulting in increased risk of ventricular arrhythmia (Aubin et al., 2010). Taken together, both DMBA and obesity have separately been shown to affect Cx gene mRNA and protein levels in non-ovarian tissues, thus this study investigated their impact on ovarian Cx mRNA and protein levels using a mouse model of progressive obesity.
Methods and Materials
Reagents
DMBA (CAS # 57-97-6), sesame oil (CAS # 8008-74-0), 2-β-mercaptoethanol, 30% acrylamide/0.8% bisacrylamide, ammonium persulphate, glycerol, N′N′N′N′-Tetramethylethylenediamine (TEMED), Tris base, Tris HCL, Sodium chloride, Tween-20 were purchased from Sigma-Aldrich Inc. (St Louis, MO). RNeasy Mini kit, QIA shredder kit, RNeasy Min Elute kit, and Quantitect TM SYBR Green PCR kit were purchased from Qiagen Inc (Valencia, CA). All primers were purchased from the Iowa State University DNA facility. All primary antibodies were purchased from Abcam (Cambridge, MA). RNA later was obtained from Ambion Inc. (Austin, TX). Goat anti-rabbit secondary antibodies were obtained from Santa Cruz Biotechnology (Santa Cruz, CA). Ponceau S was from Fisher Scientific. ECL plus chemical luminescence detection kit was obtained from GE Healthcare, Amersham (Buckinghamshire, UK).
Animals
The ovarian tissues utilized in this study were obtained as part of a larger study by our group (Nteeba et al., 2014a; Nteeba et al., 2014b). Briefly, four week old female wild type normal non-agouti (a/a; designated lean) and agouti lethal yellow (KK.Cg-Ay/J; designated obese) were purchased from Jackson laboratories (Bar Harbor, ME 002468). All animals were housed in cages under a 12 h light/dark photoperiod with the temperature between 70–73°F and humidity approximately 20–30%. The animals were provided with a standard diet (Teklad 2014 global 14% protein rodent maintenance diet) with ad libitum access to food and water until 6, 12, 18 or 24 wks of age (n = 5 per strain, per time point). Also, a subset of 18 wk old mice were dosed with sesame oil (vehicle control; n = 5 lean; n = 5 obese) or DMBA (1mg/kg; intraperitoneal injection; n = 5 lean; n = 5 obese) for 14 days and ovaries collected 3 days after the end of exposure. At the end of DMBA dosing and tissue collection, animals were 20.5 wks of age. This DMBA dose was chosen based on the literature to induce approximately 50% primordial follicle loss (Borman et al., 2000). Long term phenotypic impact observations of DMBA on fertility were outside the timeline of this study. All procedures were approved by the Iowa State University Animal Care and Use Committee.
Tissue collection
Mice were euthanized in their pro-estrus phase of cyclicity by CO2 asphyxiation. Ovaries were collected and cleaned. One ovary was stored in RNAlater at -80°C for RNA and protein analyses with the contralateral ovary was fixed in 4% paraformaldehyde for immunostaining. The ovary stored at -80°C was powdered and evenly divided for RNA and protein isolation. As a note, one ovary from an obese DMBA-treated female could not be localized therefore the final number in this group was n = 4, with n = 5 for all other treatments.
RNA isolation and quantitative RT-PCR
RNA was isolated (n = 4–5) using an RNeasy Mini kit (Qiagen) and the concentration determined using an ND-1000 Spectrophotometer (λ = 260/280nm; NanoDrop technologies, Inc., Wilmington, DE) (n=3). Total RNA (200 ng) was reverse transcribed to cDNA utilizing the Superscript III One-Step RT-PCR (Qiagen). Three randomly chosen cDNA samples per treatment were diluted (1:20) in RNase-free water and amplified in triplicate on an Eppendorf PCR Master cycler using a Quantitect SYBR Green PCR kit (Qiagen). Primers for Cx37, Cx43 and Cx45 and Gapdh were designed by Primer 3 Input Version (0.4.0) (Table 1). The regular cycling program consisted of a 15 min hold at 95°C and 45 cycles of denaturing at 95°C for 15 s, annealing at 58°C for 15 s, and extension at 72°C for 20 s at which point data were acquired. There was no difference in Gapdh mRNA expression between treatments, thus each sample was normalized to Gapdh before quantification. Quantification of fold-change in gene expression was performed using the 2 method (Livak and Schmittgen, 2001; Pfaffl, 2001).
Table 1
Primer sequence used for qPCR
| Gene | Forward primer | Reverse primer |
|---|---|---|
| Cx37 | TGATCACAGGTGGTTCTGGA | AGGAGAAGTGGGGTGTGATG |
| Cx43 | TGCAAGTGTGTAAGCGTGTG | TTGCACGGCAGGAATTCTAT |
| Cx45 | TGGTTGGGCTTAAAACTTGG | CAGCTCCACCTTCAGAGTCC |
| Gapdh | GTGGACCTCATGGCCTACAT | GGATGGAATTGTGAGGGAGA |
Protein isolation and western blotting
Protein was isolated from whole ovaries (n = 4–5) by homogenization in tissue lysis buffer containing protease and phosphatase inhibitors as previously described (Ganesan and Keating, 2014). Briefly, homogenized samples were placed on ice for 30 min, followed by two rounds of centrifugation at 10,000 rpm for 15 min and protein concentration was measured using a standard BCA protocol. SDS-PAGE was used to separate protein homogenates from three randomly chosen samples per time point or treatment which were then transferred to a nitrocellulose membrane. Membranes were blocked for 1 hour in 5 % milk in Tris-buffered saline containing Tween 20, followed by incubation in anti-rabbit CX37, CX43 and CX45 primary antibodies (1:100) for 36 h at 4°C. Following three washes in TTBS (1X), membranes were incubated with species-specific secondary antibodies (1:3000) for 1 h at room temperature. Membranes were washed 3X in TTBS and incubated in enhanced chemiluminescence detection substrate (ECL plus) for 5 min followed by X-ray film exposure. Densitometry of the appropriate bands was performed using ImageJ software (NCBI). Equal protein loading was confirmed by Ponceau S staining of membranes and protein level was normalized to Ponceau S densitometry values.
Immunofluorescence staining
Ovaries (n = 4–5) were serially sectioned (5 μM thickness) and every 10th section was mounted. Slides from three randomly chosen ovaries were deparaffinized in xylene and rehydrated with subsequent washes in ethanol. Antigen retrieval was carried out by microwaving sections for 7 min in sodium citrate buffer (1M, pH 6.1). Sections were then blocked in 5% BSA for 1 h at room temperature. Sections were incubated with primary antibody directed against CX37 (1:200), CX43 (1:200) or CX45 (1:100) overnight at 4°C. After washing in 1% PBS, sections were incubated with the appropriate goat anti-rabbit IgG-FITC secondary antibody for 1 h. Slides were then counterstained with 4–6-diamidino-2-phenylindole (DAPI) nuclear stain for 5 min. Images were captured using a Leica fluorescent microscope and protein expression analyzed using ImageJ software (NCBI). Immunofluorescence staining for CX37, CX43 or CX45 was quantified within the entire follicle; 10 antral follicles per ovary and 3 ovaries (randomly chosen) were used.
Statistical analysis
Sufficient numbers of animals and repetitions within analyses were utilized for statistical analysis. Raw data were analyzed by unpaired t-test using Graphpad Prism 5.04 software. Values are expressed as fold change ± SE for mRNA expression and raw data mean ± SE for protein results, n=3. Different letters or asterisk (*) indicate statistical significance at P < 0.05.
Reagents
DMBA (CAS # 57-97-6), sesame oil (CAS # 8008-74-0), 2-β-mercaptoethanol, 30% acrylamide/0.8% bisacrylamide, ammonium persulphate, glycerol, N′N′N′N′-Tetramethylethylenediamine (TEMED), Tris base, Tris HCL, Sodium chloride, Tween-20 were purchased from Sigma-Aldrich Inc. (St Louis, MO). RNeasy Mini kit, QIA shredder kit, RNeasy Min Elute kit, and Quantitect TM SYBR Green PCR kit were purchased from Qiagen Inc (Valencia, CA). All primers were purchased from the Iowa State University DNA facility. All primary antibodies were purchased from Abcam (Cambridge, MA). RNA later was obtained from Ambion Inc. (Austin, TX). Goat anti-rabbit secondary antibodies were obtained from Santa Cruz Biotechnology (Santa Cruz, CA). Ponceau S was from Fisher Scientific. ECL plus chemical luminescence detection kit was obtained from GE Healthcare, Amersham (Buckinghamshire, UK).
Animals
The ovarian tissues utilized in this study were obtained as part of a larger study by our group (Nteeba et al., 2014a; Nteeba et al., 2014b). Briefly, four week old female wild type normal non-agouti (a/a; designated lean) and agouti lethal yellow (KK.Cg-Ay/J; designated obese) were purchased from Jackson laboratories (Bar Harbor, ME 002468). All animals were housed in cages under a 12 h light/dark photoperiod with the temperature between 70–73°F and humidity approximately 20–30%. The animals were provided with a standard diet (Teklad 2014 global 14% protein rodent maintenance diet) with ad libitum access to food and water until 6, 12, 18 or 24 wks of age (n = 5 per strain, per time point). Also, a subset of 18 wk old mice were dosed with sesame oil (vehicle control; n = 5 lean; n = 5 obese) or DMBA (1mg/kg; intraperitoneal injection; n = 5 lean; n = 5 obese) for 14 days and ovaries collected 3 days after the end of exposure. At the end of DMBA dosing and tissue collection, animals were 20.5 wks of age. This DMBA dose was chosen based on the literature to induce approximately 50% primordial follicle loss (Borman et al., 2000). Long term phenotypic impact observations of DMBA on fertility were outside the timeline of this study. All procedures were approved by the Iowa State University Animal Care and Use Committee.
Tissue collection
Mice were euthanized in their pro-estrus phase of cyclicity by CO2 asphyxiation. Ovaries were collected and cleaned. One ovary was stored in RNAlater at -80°C for RNA and protein analyses with the contralateral ovary was fixed in 4% paraformaldehyde for immunostaining. The ovary stored at -80°C was powdered and evenly divided for RNA and protein isolation. As a note, one ovary from an obese DMBA-treated female could not be localized therefore the final number in this group was n = 4, with n = 5 for all other treatments.
RNA isolation and quantitative RT-PCR
RNA was isolated (n = 4–5) using an RNeasy Mini kit (Qiagen) and the concentration determined using an ND-1000 Spectrophotometer (λ = 260/280nm; NanoDrop technologies, Inc., Wilmington, DE) (n=3). Total RNA (200 ng) was reverse transcribed to cDNA utilizing the Superscript III One-Step RT-PCR (Qiagen). Three randomly chosen cDNA samples per treatment were diluted (1:20) in RNase-free water and amplified in triplicate on an Eppendorf PCR Master cycler using a Quantitect SYBR Green PCR kit (Qiagen). Primers for Cx37, Cx43 and Cx45 and Gapdh were designed by Primer 3 Input Version (0.4.0) (Table 1). The regular cycling program consisted of a 15 min hold at 95°C and 45 cycles of denaturing at 95°C for 15 s, annealing at 58°C for 15 s, and extension at 72°C for 20 s at which point data were acquired. There was no difference in Gapdh mRNA expression between treatments, thus each sample was normalized to Gapdh before quantification. Quantification of fold-change in gene expression was performed using the 2 method (Livak and Schmittgen, 2001; Pfaffl, 2001).
Table 1
Primer sequence used for qPCR
| Gene | Forward primer | Reverse primer |
|---|---|---|
| Cx37 | TGATCACAGGTGGTTCTGGA | AGGAGAAGTGGGGTGTGATG |
| Cx43 | TGCAAGTGTGTAAGCGTGTG | TTGCACGGCAGGAATTCTAT |
| Cx45 | TGGTTGGGCTTAAAACTTGG | CAGCTCCACCTTCAGAGTCC |
| Gapdh | GTGGACCTCATGGCCTACAT | GGATGGAATTGTGAGGGAGA |
Protein isolation and western blotting
Protein was isolated from whole ovaries (n = 4–5) by homogenization in tissue lysis buffer containing protease and phosphatase inhibitors as previously described (Ganesan and Keating, 2014). Briefly, homogenized samples were placed on ice for 30 min, followed by two rounds of centrifugation at 10,000 rpm for 15 min and protein concentration was measured using a standard BCA protocol. SDS-PAGE was used to separate protein homogenates from three randomly chosen samples per time point or treatment which were then transferred to a nitrocellulose membrane. Membranes were blocked for 1 hour in 5 % milk in Tris-buffered saline containing Tween 20, followed by incubation in anti-rabbit CX37, CX43 and CX45 primary antibodies (1:100) for 36 h at 4°C. Following three washes in TTBS (1X), membranes were incubated with species-specific secondary antibodies (1:3000) for 1 h at room temperature. Membranes were washed 3X in TTBS and incubated in enhanced chemiluminescence detection substrate (ECL plus) for 5 min followed by X-ray film exposure. Densitometry of the appropriate bands was performed using ImageJ software (NCBI). Equal protein loading was confirmed by Ponceau S staining of membranes and protein level was normalized to Ponceau S densitometry values.
Immunofluorescence staining
Ovaries (n = 4–5) were serially sectioned (5 μM thickness) and every 10th section was mounted. Slides from three randomly chosen ovaries were deparaffinized in xylene and rehydrated with subsequent washes in ethanol. Antigen retrieval was carried out by microwaving sections for 7 min in sodium citrate buffer (1M, pH 6.1). Sections were then blocked in 5% BSA for 1 h at room temperature. Sections were incubated with primary antibody directed against CX37 (1:200), CX43 (1:200) or CX45 (1:100) overnight at 4°C. After washing in 1% PBS, sections were incubated with the appropriate goat anti-rabbit IgG-FITC secondary antibody for 1 h. Slides were then counterstained with 4–6-diamidino-2-phenylindole (DAPI) nuclear stain for 5 min. Images were captured using a Leica fluorescent microscope and protein expression analyzed using ImageJ software (NCBI). Immunofluorescence staining for CX37, CX43 or CX45 was quantified within the entire follicle; 10 antral follicles per ovary and 3 ovaries (randomly chosen) were used.
Statistical analysis
Sufficient numbers of animals and repetitions within analyses were utilized for statistical analysis. Raw data were analyzed by unpaired t-test using Graphpad Prism 5.04 software. Values are expressed as fold change ± SE for mRNA expression and raw data mean ± SE for protein results, n=3. Different letters or asterisk (*) indicate statistical significance at P < 0.05.
Results
Effect of progressive obesity on Cx37 mRNA and protein abundance
In lean mice, Cx37 mRNA levels were increased (P < 0.05) at 24 wks compared to earlier time points (Figure 1A). This increase was absent in obese ovaries (Figure 1B). Comparison of both strains demonstrated lower (P < 0.05) ovarian Cx37 mRNA abundance in the obese mice at 24 wks of age (Figure 1C). In lean mice, ovarian CX37 protein level was decreased (P < 0.05) at 18 and 24 wks, relative to 6 and 12 wks of age, with this decline being greater (P < 0.05) at 24 wks than 18 wks (Figure 1D). In obese mice, CX37 protein also progressively decreased over time (Figure 1E). Ovarian CX37 protein was higher (P < 0.05) in obese mice at 12 wks and lower (P < 0.05) at 24 wks, relative to lean counterparts (Figure 1F,G).
Ovaries were collected from 6, 12, 18 or 24 wks aged mice to isolate RNA and protein to perform qRT-PCR (A–C) and western blot (D–G). Analysis between lean alone (A, D), obese alone (B, E) and between lean and obese or interaction (C, F) and values are expressed as fold change ± SE for mRNA expression and raw data mean ± SE for protein expression; n=3. Different letters or asterisk (*) indicate the statistical significance at P < 0.05.
Progressive obesity impact on Cx43 mRNA and protein level
Temporally increased (P < 0.05) Cx43 mRNA was observed in both lean and obese mice (Figure 2A,B). Increased (P < 0.05) Cx43 mRNA was evident at 12 wks due to obesity, which was decreased (P < 0.05) by 18 and 24 wks of age (Figure 2C). Ovarian CX43 protein levels were slightly increased (P < 0.05) temporally in lean mice (Figure 2D) but decreased (P < 0.05) over time in obese mice (Figure 2E). Total CX43 was lower (P < 0.05) in obese relative to lean ovaries at 18 and 24 wks (Figure 2F,G).
Ovaries were collected from 6, 12, 18 and 24 wks of age to isolate RNA and protein to perform qRT-PCR (A–C) and western blot (D–G). Analysis between lean alone (A, D), obese alone (B, E) and between lean and obese or interaction (C, F) and values are expressed as fold change ± SE for mRNA expression and raw data mean ± SE for protein expression; n=3. Different letters or asterisk (*) indicate the statistical significance at P < 0.05.
Effect of obesity on ovarian Cx45 mRNA and protein abundance
A dramatic decrease (P < 0.05) in Cx45 mRNA over time in both lean and obese ovaries was noted (Figures 3A,B). Cx45 mRNA abundance was greater (P < 0.05) in obese relative to lean ovaries after 12 wks; however this effect was reversed (P < 0.05) by 18 and 24 wks of age (Figure 3C). CX45 protein level was also decreased over time in both lean and obese ovaries (Figure 3D,E). In a similar manner to Cx45 mRNA, protein levels were greater (P < 0.05) in ovaries from obese mice at 12 wks of age, and a reduction (P < 0.05) observed by 18 and 24 wks of age (Figure 3F,G).
Ovaries were collected from 6, 12, 18 and 24 wks of age to isolate RNA and protein to perform qRT-PCR (A–C) and western blot (D–G). Analysis between lean alone (A, D), obese alone (B, E) and between lean and obese interaction (C, F) and values are expressed as fold change ± SE for mRNA expression and raw data mean ± SE for protein expression; n=3. Different letters or asterisk (*) indicate statistical significance at P < 0.05.
DMBA effects on Cx37 mRNA and protein level
Basal levels of Cx37 mRNA were decreased (P < 0.05) in obese compared to lean ovaries. DMBA exposure did not impact Cx37 mRNA abundance (Figure 4A). CX37 total protein levels were not altered by obesity. DMBA did not impact CX37 total protein abundance in lean mice but decreased (P < 0.05) CX37 in ovaries from obese mice (Figure 4B,C).
Following exposure to DMBA at 1mg/kg for 14 days, total mRNA and protein were isolated to perform qRT-PCR (A) and western blot analysis (B, C). Values are expressed as fold change ± SE for mRNA expression and raw data mean ± SE for total protein; n=3. Different letters indicate the statistical significance at P < 0.05.
Impact of DMBA exposure on ovarian Cx43 mRNA and protein
Basal levels of Cx43 mRNA were not affected by obesity, however, DMBA exposure reduced (P < 0.05) Cx43 levels with an additive effect of obesity on the DMBA-induced reduction (Figure 5A). Obesity did not impact CX43 total protein level, but CX43 protein was decreased (P < 0.05) by DMBA exposure with lack of any additive effect of obesity (Figure 5B,C).
Following exposure of DMBA at 1mg/kg for 14 days, total mRNA and protein were isolated to perform qRT-PCR (A) and western blot analysis (B, C). Values are expressed as fold change ± SE for mRNA expression and raw data mean ± SE for total protein; n=3. Different letters indicate the statistical significance at P < 0.05.
Consequence of DMBA exposure on Cx45 mRNA and protein expression
Obesity reduced (P < 0.05) Cx45 mRNA abundance (Figure 6A), but there was no impact of DMBA exposure thereon. CX45 protein abundance was decreased (P < 0.05) by obesity. Levels of CX45 protein were unaltered by DMBA exposure in lean mice, but in the obese females, ovarian CX45 protein was increased (P < 0.05; Figure B, C).
Following exposure of DMBA at 1mg/kg for 14 days, total mRNA and protein were isolated to perform qRT-PCR (A) and western blot (B,C) analysis. Values are expressed as fold change ± SE for mRNA expression and raw data mean ± SE for total protein; n=3. Different letters indicate the statistical significance at P < 0.05.
Localization and quantification of obesity and DMBA effects on CX proteins
CX37 was localized to the oocyte cytoplasm of the oocyte and between the granulosa cells (Figure 7A–D). CX37 protein basal levels were lower (P < 0.05) in obese relative to lean ovaries, but there was no impact of DMBA exposure thereon (Figure 7M). CX43 was localized between granulosa cells (Figure 7E–H). Both obesity and DMBA exposure reduced (P < 0.05) CX43 protein levels but no interaction was evident (Figure 7N). CX45 protein was localized between granulosa cells (Figure 7I–L) and was lower (P < 0.05) in obese relative to lean ovaries, but no statistical impact of DMBA on CX45 was observed (Figure 7O).
Following exposure of DMBA at 1mg/kg for 14 days, paraffin embedded ovarian sections were immunostained using primary CX37, CX43 and CX45 antibodies to check the localization (A–L) and intensity of staining for CX37 (M); CX43 (N) and CX45 (O). ImageJ software was used to analyze the intensity of staining (M–O). 10 large follicles per ovary and 3 ovaries were used for protein analysis. Values are expressed as mean ± SE. Different letters indicate the statistical significance at P < 0.05.
Effect of progressive obesity on Cx37 mRNA and protein abundance
In lean mice, Cx37 mRNA levels were increased (P < 0.05) at 24 wks compared to earlier time points (Figure 1A). This increase was absent in obese ovaries (Figure 1B). Comparison of both strains demonstrated lower (P < 0.05) ovarian Cx37 mRNA abundance in the obese mice at 24 wks of age (Figure 1C). In lean mice, ovarian CX37 protein level was decreased (P < 0.05) at 18 and 24 wks, relative to 6 and 12 wks of age, with this decline being greater (P < 0.05) at 24 wks than 18 wks (Figure 1D). In obese mice, CX37 protein also progressively decreased over time (Figure 1E). Ovarian CX37 protein was higher (P < 0.05) in obese mice at 12 wks and lower (P < 0.05) at 24 wks, relative to lean counterparts (Figure 1F,G).
Ovaries were collected from 6, 12, 18 or 24 wks aged mice to isolate RNA and protein to perform qRT-PCR (A–C) and western blot (D–G). Analysis between lean alone (A, D), obese alone (B, E) and between lean and obese or interaction (C, F) and values are expressed as fold change ± SE for mRNA expression and raw data mean ± SE for protein expression; n=3. Different letters or asterisk (*) indicate the statistical significance at P < 0.05.
Progressive obesity impact on Cx43 mRNA and protein level
Temporally increased (P < 0.05) Cx43 mRNA was observed in both lean and obese mice (Figure 2A,B). Increased (P < 0.05) Cx43 mRNA was evident at 12 wks due to obesity, which was decreased (P < 0.05) by 18 and 24 wks of age (Figure 2C). Ovarian CX43 protein levels were slightly increased (P < 0.05) temporally in lean mice (Figure 2D) but decreased (P < 0.05) over time in obese mice (Figure 2E). Total CX43 was lower (P < 0.05) in obese relative to lean ovaries at 18 and 24 wks (Figure 2F,G).
Ovaries were collected from 6, 12, 18 and 24 wks of age to isolate RNA and protein to perform qRT-PCR (A–C) and western blot (D–G). Analysis between lean alone (A, D), obese alone (B, E) and between lean and obese or interaction (C, F) and values are expressed as fold change ± SE for mRNA expression and raw data mean ± SE for protein expression; n=3. Different letters or asterisk (*) indicate the statistical significance at P < 0.05.
Effect of obesity on ovarian Cx45 mRNA and protein abundance
A dramatic decrease (P < 0.05) in Cx45 mRNA over time in both lean and obese ovaries was noted (Figures 3A,B). Cx45 mRNA abundance was greater (P < 0.05) in obese relative to lean ovaries after 12 wks; however this effect was reversed (P < 0.05) by 18 and 24 wks of age (Figure 3C). CX45 protein level was also decreased over time in both lean and obese ovaries (Figure 3D,E). In a similar manner to Cx45 mRNA, protein levels were greater (P < 0.05) in ovaries from obese mice at 12 wks of age, and a reduction (P < 0.05) observed by 18 and 24 wks of age (Figure 3F,G).
Ovaries were collected from 6, 12, 18 and 24 wks of age to isolate RNA and protein to perform qRT-PCR (A–C) and western blot (D–G). Analysis between lean alone (A, D), obese alone (B, E) and between lean and obese interaction (C, F) and values are expressed as fold change ± SE for mRNA expression and raw data mean ± SE for protein expression; n=3. Different letters or asterisk (*) indicate statistical significance at P < 0.05.
DMBA effects on Cx37 mRNA and protein level
Basal levels of Cx37 mRNA were decreased (P < 0.05) in obese compared to lean ovaries. DMBA exposure did not impact Cx37 mRNA abundance (Figure 4A). CX37 total protein levels were not altered by obesity. DMBA did not impact CX37 total protein abundance in lean mice but decreased (P < 0.05) CX37 in ovaries from obese mice (Figure 4B,C).
Following exposure to DMBA at 1mg/kg for 14 days, total mRNA and protein were isolated to perform qRT-PCR (A) and western blot analysis (B, C). Values are expressed as fold change ± SE for mRNA expression and raw data mean ± SE for total protein; n=3. Different letters indicate the statistical significance at P < 0.05.
Impact of DMBA exposure on ovarian Cx43 mRNA and protein
Basal levels of Cx43 mRNA were not affected by obesity, however, DMBA exposure reduced (P < 0.05) Cx43 levels with an additive effect of obesity on the DMBA-induced reduction (Figure 5A). Obesity did not impact CX43 total protein level, but CX43 protein was decreased (P < 0.05) by DMBA exposure with lack of any additive effect of obesity (Figure 5B,C).
Following exposure of DMBA at 1mg/kg for 14 days, total mRNA and protein were isolated to perform qRT-PCR (A) and western blot analysis (B, C). Values are expressed as fold change ± SE for mRNA expression and raw data mean ± SE for total protein; n=3. Different letters indicate the statistical significance at P < 0.05.
Consequence of DMBA exposure on Cx45 mRNA and protein expression
Obesity reduced (P < 0.05) Cx45 mRNA abundance (Figure 6A), but there was no impact of DMBA exposure thereon. CX45 protein abundance was decreased (P < 0.05) by obesity. Levels of CX45 protein were unaltered by DMBA exposure in lean mice, but in the obese females, ovarian CX45 protein was increased (P < 0.05; Figure B, C).
Following exposure of DMBA at 1mg/kg for 14 days, total mRNA and protein were isolated to perform qRT-PCR (A) and western blot (B,C) analysis. Values are expressed as fold change ± SE for mRNA expression and raw data mean ± SE for total protein; n=3. Different letters indicate the statistical significance at P < 0.05.
Localization and quantification of obesity and DMBA effects on CX proteins
CX37 was localized to the oocyte cytoplasm of the oocyte and between the granulosa cells (Figure 7A–D). CX37 protein basal levels were lower (P < 0.05) in obese relative to lean ovaries, but there was no impact of DMBA exposure thereon (Figure 7M). CX43 was localized between granulosa cells (Figure 7E–H). Both obesity and DMBA exposure reduced (P < 0.05) CX43 protein levels but no interaction was evident (Figure 7N). CX45 protein was localized between granulosa cells (Figure 7I–L) and was lower (P < 0.05) in obese relative to lean ovaries, but no statistical impact of DMBA on CX45 was observed (Figure 7O).
Following exposure of DMBA at 1mg/kg for 14 days, paraffin embedded ovarian sections were immunostained using primary CX37, CX43 and CX45 antibodies to check the localization (A–L) and intensity of staining for CX37 (M); CX43 (N) and CX45 (O). ImageJ software was used to analyze the intensity of staining (M–O). 10 large follicles per ovary and 3 ovaries were used for protein analysis. Values are expressed as mean ± SE. Different letters indicate the statistical significance at P < 0.05.
Discussion
Our previous work has demonstrated that the level of microsomal epoxide hydrolase (mEH), an enzyme required for ovarian DMBA bioactivation (Keating et al., 2008; Igawa et al., 2009), is higher in ovaries of obese mice, potentially predisposing them to increased DMBA-induced ovotoxicity (Nteeba et al., 2014a). Also, obese, DMBA-treated mice had elevated levels of a marker of double stranded DNA damage (γH2AX) as well as a blunted ovarian DNA damage repair response (Ganesan et al., in press). High fat diet fed mice have increased levels of apoptosis in cumulus oocyte complexes and granulosa cells (Wu et al., 2010) and reduced cardiac Cx expression in female rats (Aubin et al., 2010), potentially supporting that obesity alters CX protein abundance. Additionally, DMBA altered Cx gene expression in neonatal ovaries (Ganesan and Keating, 2014), however, the effect of DMBA on Cx gene expression in adult mouse ovaries has not yet been studied. Thus, the impacts of both DMBA exposure and progressive obesity on ovarian Cx mRNA and protein abundance were investigated in ovaries from adult mice.
In lean mice, ovarian Cx37 mRNA level was increased at 24 wks however total protein decreased after 18 wks potentially indicating that CX37 protein levels decline with ovarian aging. Ovaries from obese mice had lower levels of Cx37 mRNA and protein after 24 wks compared to lean ovaries, but in a similar manner to the lean mice, Cx37 mRNA and protein declined with aging in obese females. CX37 is essential for follicular development, ovulation as well as luteal tissue growth, differentiation, and regression (Simon et al., 1997). Cx37 mRNA was previously shown to be reduced in the mesenteric arteries of 25 wk old insulin resistant obese compared to lean littermate control rats (Young et al., 2008). These results indicate a decline in CX37 levels with ovarian aging.
CX37 protein was localized in the cytoplasm of oocyte (oolemma) and in the granulosa cells of large follicles, consistent with our previous study (Ganesan and Keating, 2014) and others who showed that CX37 is present on the oocyte surface of pre-antral follicles and between the granulosa cells of large antral follicles in mouse ovaries (Wright et al., 2001; Teilmann, 2005; Simon et al., 2006). Shrunken, misshapen oocytes were noted in both the obese as well as DMBA-exposed ovaries, thus analysis was confined to the entire follicular structure. CX37 antral follicle protein staining intensity was reduced in both the obese control and DMBA-treated ovaries compared to lean ovaries, in agreement with our previous work demonstrating that CX37 protein was decreased in cultured neonatal rat ovaries after DMBA exposure (Ganesan and Keating, 2014) as well as with the data from western blotting in the current study. Interestingly, obesity had a greater impact on DMBA-induced decreased CX37, suggesting DMBA may accelerate the decrease in CX37 protein levels during obesity, further contributing to ovotoxicity. Loss of organized CX37 localization around the oocyte perimeter is an early sign of follicular atresia (Teilmann, 2005), and suggests that intact cellular communication between the oocyte and the somatic cells is mandatory for follicular health. Reduced CX37 has been shown in denuded oocytes of diabetic mice compared to non-diabetic mice (Ratchford et al., 2008). Our results indicate that CX37 protein levels are reduced by aging, progressive obesity and DMBA exposure, potentially interfering with the role of CX37 during follicular development, maintenance of the germinal vesicle and ovulation.
Cx43 mRNA and protein levels were increased in lean ovaries after 18 wks which was similar to previous study that CX43 protein expression was increased in wild-type littermates compared to Gja1 mutant mice after 11 wks of age in ovaries (Flenniken et al., 2005). However, Cx43 mRNA and protein levels were decreased in ovaries of obese mice, relative to their control littermates. CX43 forms channels between granulosa cells, which is required for their proliferation (Gittens, 2003). Granulosa cells recovered from Cx43−/− mice fail to show electrical coupling (Tong et al., 2005). Thus, CX43 function is critical for ovarian function. A high fat diet induced low CX43 protein levels, which was restorable by pharmacological intervention in cardiac tissues of 32 wk old mice (Noyan-Ashraf et al., 2013). Also, decreased CX43 levels in autopsied uterine tissue were demonstrated in rats fed a high fat and high cholesterol diet (Elmes et al., 2011). Our data thus exhibit that CX43 protein levels are decreased during progressive obesity consistent with data in non-ovarian tissues.
DMBA exposure decreased Cx43 mRNA and total protein levels both in lean and obese mice ovaries in agreement with our previous study in neonatal female rat pups ovaries which indicated that DMBA reduced Cx43 mRNA and protein levels prior to follicle loss (Ganesan and Keating, 2014). Since DMBA is a component of cigarette smoke these results are in line with previous studies showing that cigarette smoke reduced CX43 expression in the corporal cavernosum of male rats (Liu et al., 2011) and in human pancreatic ductal epithelial cells (Tai et al., 2007). Cx43 mRNA and protein were also decreased in atretic follicles in rat ovaries (Wiesen and Midgley, 1994). Further, an increase in apoptotic follicles associated with a decrease in the ovarian CX43 expression was shown in acute hyperglycemic and chronic diabetic female mice (Chang et al., 2005). Immunohistochemistry staining in our study localized CX43 protein between the granulosa cells and CX43 protein staining intensity was reduced in obese ovaries. The intensity of CX43 protein staining was also reduced by DMBA exposure in lean and obese ovaries. The reduced amount of CX43 protein staining by DMBA exposure and by obesity supports that atresia is ongoing in antral follicles.
Cx45 mRNA and protein were decreased in both lean and obese ovaries after 12 wks of age but CX45 protein increased after 18 wks of age in lean ovaries. In contrast, the level of Cx45 mRNA and protein were both reduced after 18 wks of age in obese relative to lean ovaries. Also, Cx45 mRNA and total protein levels were reduced in obese ovaries compared to lean ovaries after DMBA exposure. CX45 is localized between granulosa cells and expressed throughout follicular development (Okuma et al., 1996; Wright et al., 2001). We show that CX45 protein is present between the granulosa cells of antral follicles and the intensity of protein staining was reduced by obesity. This is the first study to explore the level of ovarian CX45 protein after chemical exposure, and results indicate that CX45 is reduced by both DMBA exposure and progressive obesity. Additionally, CX45 is reported to co-localize with CX43 protein in rat ovaries (Okuma et al., 1996). Our results suggest that both CX43 and CX45 protein staining intensity were reduced by obesity and that CX43 may be more sensitive to DMBA exposure than CX45.
Taken together, ovarian Cx37, Cx43, and Cx45 show a dynamic pattern of expression and we provide evidence for decreased Cx37, Cx43, and Cx45 as a consequence of ovarian aging as well as progressive obesity. Also, for all three CX’s studied, obesity had an additive impact on DMBA exposure; CX37 and 43 were decreased while CX45 was increased, relative to their respective controls. From 12 weeks of age onwards, primordial and primary follicles were reduced by progressive obesity while secondary and antral follicle numbers were increased (Nteeba et al., 2014b). Thus the decreased levels of CX’s observed are potentially a reflection of reduced small pre-antral follicles that are present in the ovary. In the DMBA exposure study, although ovaries from obese females exposed to DMBA had lower ovarian weights, there was no apparent different in the number of follicles at any stage of development due to DMBA exposure (Nteeba et al., 2014a). In that study, however, reduced numbers of small pre-antral follicles with increased numbers of larger follicle types were also observed due to obesity, thus, the decrease in ovarian CX37 and CX43 in the obese females exposed to DMBA could be due to changes in CX levels in non-follicular cells or attributable to loss of small pre-antral follicles. However, using immunofluorescence staining, we chose the same number of follicles from which to measure CX protein staining and found reduced staining, lending support that changes observed in total CX protein are likely to reflect alterations within follicles, rather than simply a decline in follicle number, although this cannot be completely ruled out by these studies. Interestingly, in somatic cells and paradoxical to our findings, increased levels of CX43 as well as gap junction communication during programmed cell death has been noted (Wilson et al., 2000). This could represent an attempt by the tissue to protect against cell death, and our future studies are aimed at deciphering the impacts of both obesity and DMBA exposure on oocyte and granulosa Cx gene expression. In addition, determining whether ovarian impacts on Cx expression is consistent with those observed in non-ovarian tissues will be an important area for follow-on experiments.
In summary, we report that ovarian aging, obesity and DMBA exposure each alter connexin gap junction protein expression in ovaries in a manner that could contribute to compromised reproduction observed during each one of these physiological paradigms.
Acknowledgments
The project described was supported by award number R00ES016818 to AFK. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institute of Environmental Health Sciences or the National Institutes of Health.
Abstract
The ovarian gap junction proteins alpha 4 (GJA4 or connexin 37; CX37), alpha 1 (GJA1 or connexin 43; CX43) and gamma 1 (GJC1 or connexin 45; CX45) are involved in cell communication and folliculogenesis. 7,12-dimethylbenz[a]anthracene (DMBA) alters Cx37 and Cx43 expression in cultured neonatal rat ovaries. Additionally, obesity has an additive effect on DMBA-induced ovarian cell death and follicle depletion, thus, we investigated in vivo impacts of obesity and DMBA on CX protein levels. Ovaries were collected from lean and obese mice aged 6, 12, 18, or 24 wks. A subset of 18 wk old mice (lean and obese) were dosed with sesame oil or DMBA (1mg/kg; ip) for 14 days and ovaries collected 3 days thereafter. Cx43 and Cx45 mRNA and protein levels decreased (P < 0.05) after 18 wks while Cx37 mRNA and protein levels decreased (P < 0.05) after 24 wks in obese ovaries. Cx37 mRNA and antral follicle protein staining intensity were reduced (P < 0.05) by obesity while total CX37 protein was reduced (P < 0.05) in DMBA exposed obese ovaries. Cx43 mRNA and total protein levels were decreased (P < 0.05) by DMBA in both lean and obese ovaries while basal protein staining intensity was reduced (P < 0.05) in obese controls. Cx45 mRNA, total protein and protein staining intensity level were decreased (P < 0.05) by obesity. These data support that obesity temporally alters gap junction protein expression and that DMBA-induced ovotoxicity may involve reduced gap junction protein function.
Footnotes
Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.