The promoter polymorphism of NFKB1 gene contributes to susceptibility of ischemic stroke in Korean population
Abstract
The progression of ischemic stroke is associated with inflammatory response, in which the nuclear factor kappa B subunit 1 (NFKB1) plays an important role. The aim of present study was to determine whether promoter single nucleotide polymorphism (SNP) in the NFKB1 gene was contributed to susceptibility of ischemic stroke. One hundred twenty-one Korean adult patients with ischemic stroke (65.7±12.1 years in age) and 291 Korean healthy controls (63.0±9.3 years in age) were recruited. We genotyped a promoter SNP (rs11940017, −1727, C/T) of NFKB1 gene using direct sequencing in 121 Korean ischemic stroke patients and 291 control subjects. The T/C genotype of rs11940017 SNP in the codominant model (vs. the T/T genotype) (odds ratio [OR], 0.38; 95% confidence interval [CI], 0.15–0.92; P=0.032) and the genotype containing C allele (T/C and C/C) in the dominant model (vs. the T/T genotype) (OR, 0.33; 95% CI, 0.14–0.81; P=0.0068) were associated with a decreased risk of ischemic stroke. The frequency of C allele was decreased in ischemic stroke patients, compared with control subjects (OR, 0.31; 95% CI, 0.13–0.74; P=0.008). These results suggest that the promoter SNP (rs11940017, −1727, C/T) of NFKB1 gene may affect ischemic stroke susceptibility in Korean population.
INTRODUCTION
Ischemic stroke terms a condition caused by the occlusion of a blood vessel supplying the brain (Ceulemans et al., 2010) and represents more than 80% of all stroke cases (Candelario-Jalil, 2009; Durukan and Tatlisumak, 2007). Recent evidence indicates that inflammation plays an important role in ischemic stroke (McColl et al., 2009). Chronic inflammatory response is associated with stroke and neurodegenerative diseases (Frank-Cannon et al., 2009; Lucas et al., 2006). Moreover, after cerebral ischemia, the death of ischemic neurons and the release of necrotic cell debris trigger a robust inflammatory reaction (Lelekov-Boissard et al., 2009; Simi et al., 2007; Wang et al., 2007). Many therapeutic trials for inflammation-associated brain injuries have been applied (Cho et al., 2015; Han et al., 2016; Shin et al., 2016).
Nuclear factor-kappaB (NFKB) is a major transcription regulator of immune response, apoptosis, and cell-growth control genes (Karban et al., 2004). It plays a central role in modulation of inflammation (Orozco et al., 2005). The NFKB names a variety of transcription factors that are homo- or hetero-dimers of p50, p52, p65, RelB, and c-Rel (Pereira and Oakley, 2008; Perkins, 2007). Of those subunits, the p50, encoded by NFKB1 gene, is known to have both pro- and anti-inflammatory properties. The p50/p65 heterodimer stimulates transcription of pro-inflammatory cytokines, whereas the p50/p50 homodimer induces transcription of anti-inflammatory cytokine (Cao et al., 2006; Ghosh et al., 1998; Pereira and Oakley, 2008; Perkins, 2007). Thus, the expression of NFKB1 gene may be related to balancing the inflammatory response (Pereira and Oakley, 2008).
Considering the known relevance of inflammation in ischemic stroke, a possible role of NFKB1 gene polymorphisms on susceptibility to ischemic stroke cannot be ruled out. We analyzed single nucleotide polymorphism (SNP) in the promoter of NFKB1 gene and investigated the genetic association between susceptibility of ischemic stroke and NFKB1 gene in Korean population.
MATERIALS AND METHODS
Subjects
One hundred twenty-one Korean adult patients with ischemic stroke (65.7±12.1 years in age, mean±standard deviation) and 291 Korean healthy controls (63.0±9.3 years) were enrolled for this study. The patient group was comprised of 68 males and 53 females. Each patient was diagnosed using the cranial computed tomography, magnetic resonance imaging (MRI), or angiography. The patients were classified by well-trained two physicians into clinical phenotypes according to the results of the National Institutes of Health Stroke Survey (NIHSS) and the Modified Barthel Index (MBI), respectively. The neurological deficit on admission was measured using the NIHSS. The outcome at hospital discharge was assessed using the MBI. Patients with trauma, vascular malformations, brain tumors, and congenital brain disorders were excluded. The control group was comprised of 152 men and 139 women. Healthy control subjects were selected among participants examined in a general health check-up program. Participants with transient ischemic attack, ischemic heart diseases, and other atherosclerotic diseases were excluded. Age and gender of the control group was matched with those of the patient group. A summary of demographic findings of ischemic stroke patients and control subjects were provided in Table 1. Written informed consent was obtained from each patient or the legal guardian. The protocol for this study was approved by the ethics review committee of the Medical Research Institute, School of Medicine, Kyung Hee University (Seoul, Korea).
SNP selection and genotyping
We searched SNPs of NFKB1 gene in the coding and promoter regions. Relevant information was obtained from the National Center for Biotechnology Information SNP database (http://www.ncbi.nlm.nih.gov/SNP; dbSNP BUILD 131). There were 16 SNPs with a heterozygosity >0.1 in the coding and promoter regions of NFKB1. Of those SNPs, all of 6 SNPs in the coding region and 9 of 10 SNPs in the promoter region were excluded because of monomorphic genotype. Consequently, rs11940017 (−1727, C/T) in the promoter region was selected.
Peripheral blood samples were collected from each subject and then stored in a −20°C refrigerator. Genomic DNA was extracted from the blood samples using a QIAamp DNA mini kit (QIAGEN, Valencia, CA, USA). SNP genotyping was conducted by direct sequencing (MACROGEN, Seoul, Korea). Polymerase chain reactions (PCRs) were performed with specific primer for rs11940017 (Table 2). The PCR products were sequenced using an ABI PRISM 3730XL DNA Analyzer (PE Applied Biosystems Inc., Foster City, CA, USA). Sequence data were analyzed using SeqManII software (DNASTAR Inc., Madison, WI, USA).
Statistical analysis
The SNPStats (Biostatistics and Bioinformatics Unit, Barcelona, Spain) was used to analyze genetic data. Hardy-Weinberg equilibrium (HWE) was assessed. The effects of SNP genotypes were analyzed using 4 models; codominant (codominant 1: T/T [reference] vs. T/C; codominant 2: T/T vs. C/C), dominant (T/T [reference] vs. T/C+C/C), recessive (T/T+T/C [reference] vs. C/C), and log- additive (T/T vs. T/C vs. C/C) models (Yang, 2017a; Yang, 2017b). Logistic regression analyses were used to calculate the odds ratios (ORs), 95% confidence intervals (CIs), and P-values with controlling age and gender as covariables. Allele frequencies were compared by Pearson chi-square test. Statistical analyses were performed using SPSS ver. 17.0 (SPSS Inc., Chicago, IL, USA). The significance level for statistical test was set at P-value of <0.05.
RESULTS
Genotype distribution of rs11940017 SNP (−1727, C/T) of NFKB1 gene in the control group was consistent with the HWE (P>0.05; data not shown). The genotyping data revealed that rs11940017 SNP (−1727, C/T) was associated with the susceptibility of ischemic stroke (Table 3). The frequencies of T/T, T/C, and C/C genotypes were 86.2%, 12.4%, and 1.4%, respectively in the control group, and 95.0%, 5.0%, and 0% in the ischemic stroke group, respectively. The T/C genotype was associated with a decreased risk of ischemic stroke, compared to the T/T genotype (codominant model; OR, 0.38; 95% CI, 0.15–0.92; P=0.032). In the analysis using the dominant model, the genotype containing C allele (T/C and C/C) was associated with a decreased risk of ischemic stroke, compared to the T/T genotype (OR, 0.33; 95% CI, 0.14–0.81; P=0.0068). The frequencies of T and C alleles were 92.4% and 7.6%, respectively in the control group, and 97.5% and 2.5%, respectively in the ischemic stroke group (OR, 0.31; 95% CI, 0.13–0.74; P=0.008). These data suggest that the promoter SNP (rs11940017, −1727, C/T) of NFKB1 gene was associated with susceptibility of ischemic stroke.
DISCUSSION
The relation between peripheral immune cells and the brain has been suggested (Park et al., 2016). In this study, we observed that the NFKB1 promoter polymorphism, rs11940017 (−1727, C/T), was associated with ischemic stroke. We particularly found that the C allele of rs11940017 might contribute to a decreased risk of ischemic stroke in Korean population.
The NFKB1 gene encodes a 105 kD non-DNA-binding protein (p105) of nuclear factor-kappa B (NF-κB), which can undergo cotranslational processing to produce a 50-kD DNA-binding protein (p50) (Karban et al., 2004). NF-κB names a number of different transcription factors that are homo- or hetero-dimers of p50, p52, p65, RelB and c-Rel (Pereira and Oakley, 2008; Perkins, 2007). The major form of NF-κB is a heterodimer of the p50 and p65 subunits (Chen et al., 1999). The p50 subunit, encoded by NFKB1 gene, has both pro- and anti-inflammatory properties: As part of the p50/p65 heterodimer, the p50 controls transcription of pro-inflammatory cytokines such as tissue necrosis factor and interleukin-1β (Perkins, 2007). In the p50/p50 homodimer, it has anti-inflammatory properties by repressing transcription of pro-inflammatory cytokines and by stimulating transcription of anti-inflammatory cytokine (Cao et al., 2006; Ghosh et al., 1998; Pereira and Oakley, 2008). Thus, the relative abundance of p50/p65 heterodimers and p50 homodimers may determine the magnitude of inflammation by balancing the pro-inflammatory and anti-inflammatory responses (Pereira and Oakley, 2008). If an altered NFKB1 transcription would lead to a decreased p50 synthesis, fewer p50 homodimers may be formed and a stronger activation of transcription of pro-inflammatory genes can be induced (Borm et al., 2005). Given this role in inflammatory processes, polymorphisms in the promoter of NFKB1 may modulate the susceptibility to ischemic stroke because inflammation is a risk factor for ischemic stroke.
Some clinical studies investigated a relation between a functional promoter polymorphism of NFKB1 gene and immune-mediated diseases including ulcerative colitis (Borm et al., 2005; Karban et al., 2004), acute respiratory distress syndrome (Adamzik et al., 2007; Bajwa et al., 2011), cervical cancer, dilated cardiomyopathy (Zhou et al., 2009), and coronary heart disease (Vogel et al., 2011). However, the genetic association between NFKB1 polymorphisms and ischemic stroke has not been published in the literature, even though the NF-κB pathway is suggested as one of mechanisms of ischemic stroke (Martín-Ventura et al., 2004; Nurmi et al., 2004). Thus, we searched SNPs in the promoter and coding regions of NFKB1 gene and selected a promoter polymorphism, rs11940017. In our data, the C allele was the minor allele of rs11940017 and was related to a lower risk of ischemic stroke (OR, 0.31; 95% CI, 0.13–0.74). The genotype containing C allele was further decreased in patients with ischemic stroke. We presumed that the relative frequency of the T and C alleles of rs11940017 might be able to alter the activity of NFKB1 transcription. We expect, in the further study, to simultaneously investigate the genotype frequencies and the NF-κB activity between ischemic stroke patients and control subjects.
In conclusion, we found statistically significant association between rs11940017 SNP of NFKB1 gene and the susceptibility to ischemic stroke in Korean population. Here in this study, we report a relation between NFKB1 gene and ischemic stroke.
| Variable | Ischemic stroke (n=12) | Control (n=291) |
|---|---|---|
| Age (yr) | 65.7±12.1 | 63.0±9.3 |
| Male | 68 (56.2) | 152 (52.2) |
| Female | 53 (43.8) | 139 (47.8) |
| <6 | 56 | - |
| ≥6 | 57 | - |
| <60 | 71 | - |
| ≥60 | 25 | - |
| SNP | Sequence (5′-3′) | Product size (bp) | Annealing temperature (°C) | |
|---|---|---|---|---|
| rs11940017 (−1727, C/T) | Sense | CATCTCCTCTCTCTGCCAAGTT | 391 | 59 |
| Antisense | GAACCTGGGGGGAGGGGTTACT | - | - |
Genotype and allele frequencies of NFKB1 polymorphism in control subjects and ischemic stroke patients
| SNP | Genotype & allele | Control | Ischemic stroke | Model | OR (95% CI) | P-value |
|---|---|---|---|---|---|---|
| rs11940017 promoter (−1727, C/T) | Genotype | |||||
| T/T | 251 (86.2) | 115 (95.0) | Codominant 1 | 0.38 (0.15–0.92) | 0.032* | |
| T/C | 36 (12.4) | 6 (5.0) | Codominant 2 | 0.00 (0.00–NA) | NA | |
| C/C | 4 (1.4) | 0 (0) | Dominant | 0.33 (0.14–0.81) | 0.0068* | |
| Recessive | 0.00 (0.00–NA) | NA | ||||
| Log-additive | 0.38 (0.16–0.94) | 0.021* | ||||
| 0.34 (0.15–0.80) | 0.0043* | |||||
| Allele | ||||||
| T | 538 (92.4) | 236 (97.5) | Reference | |||
| C | 44 (7.6) | 6 (2.5) | 0.31 (0.13–0.74) | 0.008* |
NFKB1, nuclear factor of kappa light polypeptide gene enhancer in B-cells 1; SNP, single nucleotide polymorphism; OR, odds ratio; CI, confidence interval; NA, not applicable.
P-values were from logistic regression analyses with codominant, dominant, recessive and log-additive models.
*P<0.05, statistically significant.
Footnotes
CONFLICT OF INTEREST
No potential conflict of interest relevant to this article was reported.
References
- 1. Insertion/deletion polymorphism in the promoter of NFKB1 influences severity but not mortality of acute respiratory distress syndromeIntensive Care Med20073311991203[PubMed][Google Scholar]
- 2. An NFKB1 promoter insertion/deletion polymorphism influences risk and outcome in acute respiratory distress syndrome among CaucasiansPLoS One20116e19469[PubMed][Google Scholar]
- 3. A NFKB1 promoter polymorphism is involved in susceptibility to ulcerative colitisInt J Immunogenet200532401405[PubMed][Google Scholar]
- 4. Injury and repair mechanisms in ischemic stroke: considerations for the development of novel neurotherapeuticsCurr Opin Investig Drugs200910644654[Google Scholar]
- 5. NF-κB1 (p50) homodimers differentially regulate pro- and anti-inflammatory cytokines in macrophagesJ Biol Chem20062812604126050[PubMed][Google Scholar]
- 6. The dual role of the neuroinflammatory response after ischemic stroke: modulatory effects of hypothermiaJ Neuroinflammation2010774[PubMed][Google Scholar]
- 7. New insights into the role of nuclear factor-kappaB, a ubiquitous transcription factor in the initiation of diseasesClin Chem199945717[PubMed][Google Scholar]
- 8. Ulinastatin inhibits cerebral ischemia-induced apoptosis in the hippocampus of gerbilsMol Med Rep20151217961802[PubMed][Google Scholar]
- 9. Acute ischemic stroke: overview of major experimental rodent models, pathophysiology, and therapy of focal cerebral ischemiaPharmacol Biochem Behav200787179197[PubMed][Google Scholar]
- 10. Does neuroinflammation fan the flame in neurodegenerative diseases?Mol Neurodegener2009447[PubMed][Google Scholar]
- 11. NF-κB and Rel proteins: evolutionarily conserved mediators of immune responsesAnnu Rev Immunol199816225260[PubMed][Google Scholar]
- 12. Current opinion on the role of neurogenesis in the therapeutic strategies for Alzheimer disease, Parkinson disease, and ischemic stroke; considering neuronal voiding functionInt Neurourol J201620276287[PubMed][Google Scholar]
- 13. Functional annotation of a novel NFKB1 promoter polymorphism that increases risk for ulcerative colitisHum Mol Genet2004133545[PubMed][Google Scholar]
- 14. Exploration of beneficial and deleterious effects of inflammation in stroke: dynamics of inflammation cellsPhilos Trans A Math Phys Eng Sci200936746994716[PubMed][Google Scholar]
- 15. The role of inflammation in CNS injury and diseaseBr J Pharmacol2006147Suppl 1S232240[PubMed][Google Scholar]
- 16. NF-kappaB activation and Fas ligand overexpression in blood and plaques of patients with carotid atherosclerosis: potential implication in plaque instabilityStroke200435458463[PubMed][Google Scholar]
- 17. Systemic infection, inflammation and acute ischemic strokeNeuroscience200915810491061[PubMed][Google Scholar]
- 18. Nuclear factor-kappaB contributes to infarction after permanent focal ischemiaStroke200435987991[PubMed][Google Scholar]
- 19. Analysis of the functional NFKB1 promoter polymorphism in rheumatoid arthritis and systemic lupus erythematosusTissue Antigens200565183186[PubMed][Google Scholar]
- 20. Central nervous system-peripheral immune system dialogue in neurological disorders: possible application of neuroimmunology in urologyInt Neurourol J201620Suppl 1S814[PubMed][Google Scholar]
- 21. Nuclear factor-kappaB1: regulation and functionInt J Biochem Cell Biol20084014251430[PubMed][Google Scholar]
- 22. Integrating cell-signalling pathways with NF-kappaB and IKK functionNat Rev Mol Cell Biol200784962[PubMed][Google Scholar]
- 23. Neuroprotective effects of bone marrow stromal cell transplantation in combination with treadmill exercise following traumatic brain injuryInt Neurourol J201620Suppl 1S4956[PubMed][Google Scholar]
- 24. Interleukin-1 and inflammatory neurodegenerationBiochem Soc Trans200735Pt 511221126[PubMed][Google Scholar]
- 25. The NFKB1 ATTG ins/del polymorphism and risk of coronary heart disease in three independent populationsAtherosclerosis2011219200204[PubMed][Google Scholar]
- 26. The inflammatory response in strokeJ Neuroimmunol20071845368[PubMed][Google Scholar]
- 27. Association study between ZFHX3 gene polymorphisms and obesity in Korean populationJ Exerc Rehabil2017a13491494[PubMed][Google Scholar]
- 28. Lack of association between glutathione s-transferase mu 1 (GSTM1) gene polymorphisms and obesityJ Exerc Rehabil2017b13608612[PubMed][Google Scholar]
- 29. Functional polymorphism of the NFKB1 gene promoter is related to the risk of dilated cardiomyopathyBMC Med Genet20091047[PubMed][Google Scholar]