A novel source of arterial valve cells linked to bicuspid aortic valve without raphe in mice

The intercalated cushions are morphologically distinct from the main outflow cushions

Although the presence of the IC and their participation in arterial valve leaflet development is well-recognised (Kramer, 1942) (Figure 1B), their origin and composition have not been established. We therefore analysed their development from mouse embryonic day (E)9.5 and human Carnegie stage (CS)14. At E9.5, the outflow of the heart consists of a simple tube with an outer myocardial wall, an inner layer of endocardium and an intervening acellular space filled with cardiac jelly. There was no evidence of discrete main or intercalated cushions (Figure 1C). By E10.5 the IC were first seen as anterior and posterior thickenings of the outflow tract outer wall, bulging into localised expansions of cardiac jelly heralding the main outflow tract cushions (Figure 1D and Figure 1—figure supplement 1). The IC were obvious at E11.5 as compact swellings within the distal outflow tract wall (Figure 1E) whilst rotation of the outflow tract (Bajolle et al., 2006) placed the aortic IC to the right and the pulmonary IC to the left. By E12.5, all six primordia of the forming aortic and pulmonary valve leaflets appeared morphologically similar, although packing of cells in the forming IC appeared more dense (Figure 1F). At E13.5 and E15.5 the leaflets were indistinguishable from each other using standard histological staining (Figure 1G,H). These observations were confirmed in human embryos at equivalent developmental stages (Figure 1I–L).

Although of similar appearance, the pulmonary IC became evident earlier in development and was more discrete than the aortic IC at E10.5-E11.5. Moreover, the two IC were positioned at different levels within the outflow reflecting the orientations of the adult valve structures. Thus, the pulmonary IC sits more distally by E11.5 and is surrounded laterally by a cuff of outflow tract myocardium (Figure 1M,P,R), whereas the larger aortic IC only has proximal contact with myocardium (Figure 1N,Q,R). Importantly, both IC have distal continuity with undifferentiated (non-myocardial) outflow tract wall (Figure 1O,Q and Figure 1—figure supplement 1).

IC undergo late differentiation to become valve primordia

These initial observations suggested that the origins of the IC are developmentally distinct from the main outflow cushions. To evaluate the tissue characteristics of these primordia we examined the expression of chondroitin sulphate, a component of both the extracellular matrix (ECM) of the cardiac jelly and valve primordia (Markwald et al., 1978), using CS56 antibody. We also investigated expression of cardiac troponin I (cTnI), a myocardial specific protein, to elucidate the relationships of the IC with the myocardial wall. At E10.5 cardiac jelly, labelled by CS56 antibody, was found in a circumferential layer between the myocardium and endocardium, with laterally located accumulations of cells that prefigured the main cushions (Figure 2A). Although the IC within the wall were not labelled by CS56, a thin layer of CS56-expressing cardiac jelly overlaid their luminal surface (Figure 2D,G). The outflow tract wall labelled with cTnI antibody, but despite continuity with this wall, the IC did not express cTnI. At E11.5, the main outflow tract cushions contained many cells and continued to strongly label with CS56 antibody (Figure 2B). In contrast, although the IC had expanded, they remained devoid of labelling for cTnI or for CS56, except for the thin layer of adluminal cardiac jelly (arrowheads in Figure 2E). When examined at E12.5, the main cushions and the IC labelled with the CS56 antibody (Figure 2C,F,I). To further understand the differentiation of these IC we examined them for the expression of proteins relevant to endocardial cushion differentiation. Versican is a chondroitin sulphate proteoglycan that is expressed early and plays essential roles in cushion formation (Henderson and Copp, 1998; Mjaatvedt et al., 1998). At E10.5, Versican was only detected in the cardiac jelly of the main septal cushions and the thin layer of cardiac jelly overlying the IC. However, at E11.5, prior to expression of CS56, and also at E12.5, Versican was expressed within the bulk of the IC (Figure 2J–O). At E10.5 Sox9, a transcription factor necessary for the formation of endocardial cushions and maintained in mature valve leaflets (Akiyama et al., 2004; Richardson et al., 2018), was abundantly expressed in the circumferential layer of cardiac jelly where the main cushions form, but only in the area immediately adjacent to the endothelium overlying the IC that was labelled by CS56 (Figure 2P,S – compare to 2 D,G); there was no Sox9 in the main part of the IC at this stage. At E11.5 Sox9 was also expressed throughout the IC and this was maintained at E12.5 (Figure 2Q,R,T,U). Taken together, these findings indicate that at early stages the IC are overlaid by a layer of cardiac jelly but are not endocardial cushions in the classical sense. However, as they mature they express markers of valve interstitial cells. In view of this we henceforth refer to them in this manuscript as intercalated valve swellings (ICVS) as in Kramer’s original description (Kramer, 1942).

10.7554/eLife.34110.004Figure 2.

IC are molecularly distinct from the main outflow cushions.

In each case, arrows mark the IC. * mark the main outflow cushions. In D-U the myocardium is labelled with cTnI (green). Images are typical examples from a minimum of n = 3 at each stage. (A–C) The cardiac jelly of the main outflow cushions contain chondroitin sulphate molecules, recognised by the antibody CS56, from E10.5 to E12.5, whereas these are only abundant in the IC at E12.5. (D–I) Higher power of CS56 immunoreactivity shows that although the bulk of the IC stain with neither cTnI nor CS56 at E10.5-E11.5 (arrows), they are overlaid by a layer of CS56-expressing material (arrowheads in D,E,G) that is continuity with the main outflow cushions. By E12.5, the majority of the leaflet primordium is labelled by CS56. (J–O) Versican is expressed in the cardiac jelly of the main cushions at E10.5 and the adluminal region overlying the IC (arrowhead in J,M). Versican is not found in the bulk of the IC at E10.5, (J,M) but is expressed more broadly in the IC at E11.5 and E12.5. Notably, versican is missing from the centre part of both the aortic and pulmonary IC at E12.5 (arrows in L,O). (P–U) Sox9 labels only the layer overlying the IC at E10.5 (arrowheads in P,S) but is expressed throughout the ICVS by E11.5 and at E12.5. Scale bar: A = 90 μm, B,F,I,L,O,R,U = 120 μm, C = 250 μm, D,G,J,M,P,S = 50 μm, E,H,K,N,Q,T = 70 μm.

Undifferentiated SHF cells directly contribute to the ICVS

We have previously shown that whilst NCC and EndMT-derived cells (EDC) make a major contribution to valve primordia derived from the main outflow cushions at E11.5 and E12.5, they make only a minor contribution to the laterally-placed IC (Phillips et al., 2013). These patterns are highly reproducible (n > 10). More thorough analysis showed that the proportion of Wnt1-Cre+ lineage cells was significantly different between the valve primordia, X² (df5, N = 6842)=959.4, p<0.0001 (Figure 3—source data 1). Pairwise chi-squared comparison, with Bonferroni correction for multiple testing, confirmed that the aortic posterior (non-coronary) and anterior pulmonary primordium were statistically different from all other primordia (for each, p<0.0002). Whereas the left aortic primordium was statistically different from the remaining primordia (p<0.02), the aortic right, pulmonary left and pulmonary right were not significantly different with respect to the number of Wnt1-Cre+ lineage cells they contained. Chi squared analysis showed that the proportion of Tek-Cre lineage cells between the different arterial valve primordia were significantly different, X² (df5, N = 7389)=782.3, p<0.0001 (Figure 3—source data 1). Pairwise Chi-squared comparison between the primordia, with Bonferroni correction for multiple testing, confirmed that the aortic non-coronary, the pulmonary right and the pulmonary anterior were not statistically different in the proportion of Tek-Cre+ lineage cells they contained. However, all the remaining primordia were statistically different (p<0.0002). Thus, these data showed that there were marked variations in the NCC and EDC contributing to each leaflet and confirmed that there were insufficient Wnt1-Cre+ and Tek-Cre+ lineage traced cells to account for all the cells present in these valve primordia (Figure 3A–F and Figure 3—figure supplement 1). We therefore looked for alternative sources to explain the origins of the remaining cells in the developing arterial valve leaflets. As the parietal valves of the atrioventricular valves are known to contain epicardially-derived cells (EPDC; [Gittenberger-de Groot et al., 1998; Wessels et al., 2012]). We asked whether EPDC could contribute to the ICVS or other outflow cushions. To test this, we performed tamoxifen induction in Wt1-Cre-ERT2 mice starting at E9.5. Analysis at E12.5 showed that although the epicardium itself was strongly labelled, there was no contribution of EPDC into the forming arterial valve leaflets (Figure 3G).

The dorsal pericardial wall and the pharyngeal mesoderm are composed of SHF cells that directly generate the outflow tract myocardium, much of the smooth muscle and fibrous tissue in the proximal and distal outflow vessel walls, and also the endocardium that lines these structures (Waldo et al., 2005; Harmon and Nakano, 2013; Verzi et al., 2005; Richardson et al., 2018). Moreover, the SHF through endothelial EndMT, indirectly populates the outflow tract cushions (Verzi et al., 2005); Figure 3—figure supplement 1). We wondered whether SHF progenitors might contribute to the ICVS, over and above those provided by EndMT. By lineage tracing using Mef2c-AHF-Cre, it was possible to identify all SHF-derived cells adding into the valve anlagen, either directly or through EndMT. Analysis at E11.5 and E12.5 revealed that cells derived from the Mef2c-AHF-Cre+ SHF make a major and highly reproducible contribution to all of the arterial valve leaflet primordia, including the ICVS (Figure 3H–J). Chi squared analysis following quantification of the Mef2c-AHF-Cre+ lineage cells in the E12.5 leaflet primordia showed that the proportion of these cells were significantly different between the different arterial valve primordia, X² (df5, N = 7435)=748.2, p<0.0001 (Figure 3—source data 1). Pairwise Chi-squared comparison between the primordia, with Bonferroni correction for multiple testing, confirmed that the aortic anterior (non-coronary) primordium was statistically different from all other primordia (p<0.0002), as was the pulmonary posterior primordium (p<0.0002). Moreover, whilst the right pulmonary primordium was statistically different from the remaining primordia (p<0.02); the aortic left, aortic right and pulmonary left were not significantly different. Importantly, our analysis demonstrated that the numbers and distribution of Mef2c-AHF-Cre+ lineage cells in the ICVS and in both the main cushions were complementary to the Wnt1-Cre+ lineage (compare Figure 3J with 3E) and were sufficient to explain the presence of all cells.

Origin of ICVS directly from SHF progenitors in the outflow wall

A possible source of the SHF-derived cells within the ICVS was trans-differentiation of outflow tract myocardium. To explore this, we carried out lineage tracing using the cardiomyocyte-specific Troponin T-Cre (cTnT; Tnnt2-Cre) line. Analyses of the ICVS, both during formation at E11.5 and when they resemble the main cushions at E12.5, showed that the ICVS and the adjacent outflow tract wall was indeed composed of cells demonstrating Tnnt2-Cre+ lineage (Figure 3K–M). In addition to this major contribution of Tnnt2-Cre+ lineage cells to the ICVS at these stages, a few labelled cells were also found in the right and left leaflets derived from the main septal cushions, located within the outer parts of the leaflets, close to the myocardial wall. Examination of Tnnt2-Cre;eYFP embryos at later stages of development showed that the Tnnt2-Cre+ lineage cells were found in all three arterial valves throughout gestation and postnatally, although the majority were found in the anterior/posterior leaflets; these data indicate that Tnnt2-Cre+ lineage cells make a permanent contribution to the valve leaflets (Figure 3N). However, as shown earlier, the E11.5 ICVS did not contain differentiated cardiomyocytes, thus did not express cTnT, cTnI, nor αSMA, a smooth muscle cell (SMC) marker (Figure 3O,P). As the Cre lineage tracing indicated cells that not only currently expressed cTnT, but also those that were descended from cells that previously expressed cTnT, we used antibodies directed against cTnT/cTnI together with Tnnt2-Cre lineage tracing at earlier stages of development, to establish whether cells in the ICVS ever expressed these markers. Despite their Tnnt2-Cre+ lineage labelling, the ICVS did not label with antibodies to cTnT nor cTnI at any stage of development. At E9.75, before the ICVS could be seen in the distal outflow, a region of Tnnt2-Cre+;cTnT- labelling was seen, likely indicating where the ICVS would develop (Figure 3Q–S). Similarly, At E10.5 the most distal outflow wall was Tnnt2-Cre-expressing, but did not label with cTnT antibody (Figure 3T–V). Thus, our data argue against trans-differentiation of ICVS cells from cardiomyocytes. To clarify the timing of Cre expression driven by the Tnnt2 promoter activity in the ICVS, we used an anti-Cre antibody. By examining embryos at E10.5-E12.5 we showed that at E10.5 Cre protein was found in the forming ICVS and in the myocardial wall. However, by E11.5, and continuing at E12.5, Cre protein was absent from the ICVS, although still maintained in the myocardial walls (Figure 3—figure supplement 2). Taken together these data indicate that Tnnt2-Cre activation in the forming ICVS occurred prior to full differentiation to cardiomyocytes and taking into account perdurance of Cre protein, is likely to occur before E10.5. Interestingly, Tnnt2-Cre+ lineage cells were also observed in SMC within the arterial wall later in development (Figure 3N and (Figure 3—figure supplement 3).

10.7554/eLife.34110.005Figure 3.

The ICVS are formed from undifferentiated SHF-derived cells that are labelled by TnnT2-Cre.

All sections are frontal unless otherwise stated. Arrows mark the ICVS. * mark the main outflow cushions. Images are typical examples from a minimum of n = 3 at each stage. (A–F) NCC labelled by Wnt1-Cre (A,B) make a significant contribution to the main outflow cushions and right and left valve primordia at E11.5 and E12.5, but make only a minor contribution to the ICVS and anterior leaflets (arrows). Tek-Cre labels cells in the endocardium (arrow in C), but few cells in either the main cushions or ICVS at E11.5 (C), although they are abundant in the left and right leaflets by E12.5 (D). Quantification of cells at E12.5 (E,F) confirms these observations and reveals that there are a number of cells in the leaflets, particularly the anterior and posterior derived from the ICVS, that are not labelled by NCC or EDC (data reanalysed from [Phillips et al., 2013]). (G–J) Wt1-ERT-Cre labels the epicardium (arrowheads in G) but not cells in the ICVS (arrows in G). The ICVS are labelled by Mef2c-AHF-Cre at E11.5 and E12.5 (H,I), as are the main cushions and the left and right leaflet primordia. Quantification of these cells (J) shows that the Mef2c-AHF-Cre-expressing population is the major contributor to the leaflet primordia. (K–N) Cells expressing Tnnt2-Cre label the cells in the ICVS at E11.5 (arrows in K,L) and the posterior valve leaflet primordia at E12.5 (M). A few labelled cells are also seen in the left and right primordia. (N) Tnnt2-Cre labels cells in all leaflets (arrows) of the aortic valve at P2, although it is more abundant in the posterior leaflet. Tnnt2-Cre also labels the walls of the aortic sinuses that are composed of SMC (arrowhead). (O,P) Antibodies specific for cardiac troponin-T (O), cTnI (green in P) and αSMA (red in P) label the outflow wall but not the ICVS at E11.5. (Q–V) At E9.5, a Tnnt2-Cre-positive, but cTnT-negative region (arrows in Q-S) is apparent in the distal outflow wall. A similar region can be seen in transverse sections at E10.5 (arrows in T-V). N.B. mTmG was used as the reporter line in Q-S so the GFP staining appears membrane associated in these sections. (W–Y) Some of the cells in the ICVS label co-express (yellow; arrows) Isl1 and Sox9 antibody at E11.5. Scale bar: A-D,H,K,L,M = 100 μm, G,I = 150 μm, N = 400 μm, O,p=60 μm, Q-V = 50 μm, W-Y = 40 μm.

10.7554/eLife.34110.010Figure 3—source data 1.

Raw data from lineage tracing for Wnt1-Cre+, Tek2-Cre+ and Mef2c-AHF-Cre+ cells in E12.5 valve leaflets.

elife-34110-fig3-data1.xlsx

10.7554/eLife.34110.006Figure 3—figure supplement 1.

Lineage of cells in the main outflow cushions.

Transverse sectioning confirms the reciprocal distribution of Wnt1-Cre labelled NCC and Mef2c-AHF-Cre-expressing SHF-derived cells in the main outflow cushions at E12.5. The Tek-Cre labeling of the EDC is contained within the pattern of the Mef2c-AHF-Cre. Cre-driven expression is green in each case. The white double-headed arrows denote the part of the main cushions will form valve leaflets, whereas the yellow arrow denotes the part that will be muscularised to form septal structures. The red arrows denote a region of the main cushions that are not invested by either Wnt1-Cre-expressing NCC or Tek-Cre (Tie2-Cre) expressing EDC, but are filled with Mef2c-AHF-Cre expressing cells. The ICVS is also filled with Mef2c-AHF-Cre expressing cells. Arrowheads in C show Mef2c-AHF-Cre-labelled endocardium. In A,D,C,F the red staining is aSMA, whereas in B,E it is Notch1ICD. Ao – aorta; ICVS – intercalated valve swelling; PT – pulmonary trunk.

10.7554/eLife.34110.007Figure 3—figure supplement 2.

Confirmation of timing of Cre expression.

(A-D) Anti-Cre antibody shows that ICVS cells (arrowheads) in Tnnt2-Cre+ embryos no longer express Cre protein by E11.5, showing that the Tnnt2 promoter was down-regulated prior to this stage. Cre protein expression is maintained in the myocardium (arrow) throughout the time points examined. (L) Cre protein is expressed in the myocardium and in ICVS cells in Mef2c-AHF-Cre+ embryos at E12.5 showing that the Mef2c-AHF enhancer remains active up to at least E12.5.

10.7554/eLife.34110.008Figure 3—figure supplement 3.

Tnnt2-Creexpression in SMC.

(A, B) Tnnt2-Cre is expressed by differentiating SMC in the developing arterial trunks at E13.5 (arrows in A). High power images confirm the presence of yellow co-expressing cells (arrows). (C,D) Tnnt2-Cre is found in SMC of the aortic media at P2 (arrows in C). High power images confirm the presence of yellow co-expressing cells (arrows). Tnnt2-Cre+ cells are also found in all three valve leaflets (*) at P2 but these do not-co-express αSMA.

10.7554/eLife.34110.009Figure 3—figure supplement 4.

Persistance of Isl1 expression in ICVS.

(A-C) There is only low-level expression of Isl1 in the ICVS at E12.5, although Sox9 is more widespread. A few cells (arrows) co-express both markers. (D–G) The transition zone (TZ) where cells co-express SHF progenitor (Isl1) and differentiated cardiomyocyte (cTnI) markers is seen at E10.5. By E11.5, a few cells still co-express these markers and the ICVS can be seen immediately distal to the TZ. At both stages, the myocardial outflow tract is in continuity with Isl1 expressing cells found more distally. ICVS = intercalated valve swelling.

A key question is whether these ICVS cells originate directly from undifferentiated SHF cells. As they remain in continuity with the dorsal pericardial wall, we wondered if they might also have retained an undifferentiated state. Islet 1 (Isl1) is a specific marker of multipotent SHF progenitors that are yet to differentiate into a broad range of cell types including cardiomyocytes (Cai et al., 2003). At E11.5 the ICVS were clearly delineated within the distal outflow wall by Isl1 antibody (Figure 3W,Y and Figure 3—figure supplement 4); co-localisation studies showed that some of the cells also expressed Sox9 and thus were directly differentiating into valve interstitial cells (Figure 3W–Y and Figure 3—figure supplement 4). By E12.5, Isl1 expression had essentially disappeared from the outflow tract, although persisting low level Isl1 expression was noted in a few cells in the ICVS (Figure 3—figure supplement 4). Thus, the cells within the ICVS, although of Tnnt2-Cre+ lineage, are formed from Mef2c-AHF-Cre-expressing SHF progenitor cells that maintain expression of Isl1 for longer than the surrounding cells, suggesting they differentiate later. Co-expression of reducing Isl1 protein levels but increasing Sox9 protein levels, in the setting of absence of protein for differentiated cardiomyocyte markers, supports direct derivation of valve precursors from SHF, rather than trans-differentiation from myocardial wall.

ICVS derive from SHF epithelium, but not through EMT

We have previously shown how SHF progenitor cells from the dorsal pericardial wall add to the elongating outflow tract at E9.0-E9.5 (Ramsbottom et al., 2014) and form the myocardium of the outflow tract. As they do so they initially up-regulate E-cadherin and show marked cellular polarisation. As addition continues, they lose their epithelial phenotype, down-regulate Isl1, and then express markers of differentiated cardiomyocytes in the segment of outflow tract we termed the transition zone (Ramsbottom et al., 2014). E-cadherin was expressed throughout the distal outflow wall including the forming ICVS at E10.5, (Figure 4A–C) but was not expressed in the main cushions. By E11.5 levels of E-cadherin expression were reduced in the ICVS (Figure 4D–F) and by E12.5, E-cadherin was absent (Figure 4G–I). This was paralleled by β-catenin expression, which also labels epithelial cells, (Figure 4J), but was entirely different from N-cadherin and fibroblast specific protein 1 (Fsp1) immuno labelling, both of which are markers of mesenchymal cells. Specifically, neither N-cadherin nor Fsp1 were expressed in the ICVS at any stage of development (Figure 4K,L), indicating that the ICVS do not contain typical mesenchymal cells. Interestingly, collagen I and elastin, both ECM proteins normally seen surrounding SMC in the tunica media of blood vessels and also found in mature valve leaflets (Hinton and Yutzey, 2011), were transiently expressed only in the forming ICVS but not in the surrounding walls or main cushions at E11.5 (Figure 4M–O and Figure 4—figure supplement 1). These data suggest that at E11.5 and E12.5, the ICVS cells express different markers to the cells that make up the right and left leaflets and the adjacent myocardial wall. In contrast, laminin, an ECM protein highly expressed in the basement membrane of epithelia, was highly expressed in the ICVS at E10.5 but was down-regulated by E11.5-E12.5 (Figure 4P–R). Together, these data suggest that epithelial SHF progenitors in the ICVS differentiate to valve interstitial cells, but not via an undifferentiated mesenchymal intermediate. To rule out EMT as a mechanism, we evaluated expression of Slug and Snail, key regulators of EMT, by in-situ hybridisation, focussing on E10.5 and E11.5 embryos, as by E11.5 Sox9 is found in the ICVS (Figure 2Q,T) and thus the valve cell precursors have formed. Notably, there was no expression of transcripts for either Slug or Snail within the ICVS at E10.5 or E11.5, although both were abundantly expressed in both the endothelium and newly formed mesenchyme of the main outflow cushions (Figure 4S–V and Figure 4—figure supplement 1). Thus, although the cells of the ICVS change from an epithelial to valve interstitial cell phenotype, this does not occur via classical EMT.

10.7554/eLife.34110.011Figure 4.

The ICVS transition from epithelium to mesenchyme, but not by a typical process of EMT.

Unless otherwise stated, the aortic IC is shown. Arrows point to the ICVS or posterior valve primordium in each case. * mark the main outflow cushions. Images are typical examples from a minimum of n = 3 at each stage. (A–C) The ICVS express E-cadherin (green) at E10.5 (A,B), as does the surrounding myocardial outflow wall (labelled red by cTnI), although the main cushions do not. (D–I) E-cadherin is downregulated in the ICVS at E11.5 (D,E), and is no-longer expressed by E12.5 (G,H). (J–L) β-catenin is expressed in the ICVS and the surrounding wall at E11.5 (J), but neither N-cadherin nor Fsp1 (K,L) are found in the ICVS at this stage. (M–O) Collagen-I is transiently up-regulated specifically in the ICVS but not the main cushions at E11.5, but resembles the main leaflet primordia with little if any expression at E10.5 and E12.5. (P–R) Laminin is also transiently expressed in the ICVS at E10.5, but is downregulated and lost from the valve primordia by E12.5. (S–V) Neither Slug nor Snail are expressed in the ICVS (arrows in S,U,V) at E10.5–11.5, although they are both abundant in the main cushions (* in T,U,V). Scale bar: A-I,M,N,p=60 μm, J-L,O,Q-V = 100 μm.

10.7554/eLife.34110.012Figure 4—figure supplement 1.

ICVS do not express classical mesenchymal markers as they form.

(A-C) Elastin is specifically localised to the developing ICVS but not to the main septal outflow cushions at E10.5-E12.5. (D–F) transverse sections show that Slug and Snail transcripts (purple) are found in the main outflow cushions at E10.5 and E11.5.

Jagged-Notch signalling is active and required for ICVS development

Notch1 signalling plays an essential role in formation of the atrioventricular and main outflow cushions in the developing heart. It is involved, together with its ligand Dll4, in EndMT (Luna-Zurita et al., 2010), but also acts later during valve remodelling with an alternative ligand, Jag1 (MacGrogan et al., 2016). Moreover, NOTCH1 mutations have been implicated in BAV (Garg et al., 2005). To identify the molecular mechanism underpinning formation of the ICVS we first asked whether there is Notch1 signalling activity in the ICVS. Immunolabelling confirmed that the active Notch1 receptor (Notch1 intracellular domain or N1ICD) was present in the non-myocardial walls of the aortic sac, the distal outflow and the endocardium. It was specifically expressed in cells within the ICVS at E10.5 although by E11.5 only a few cells in the cardiac jelly overlying the core of the ICVS continued to express nuclear N1ICD (Figure 5A,E,I), indicating a temporal window of Notch1 signalling activity. Immuno staining for Notch2 (using an antibody that recognised the uncleaved form of the protein) was also expressed in the membranes of cells within the ICVS but not in the main cushions (Figure 5B,F,J). Dll4 was found in the endocardium with N1ICD, but not in the ICVS at either E10.5 or E11.5 (Figure 5—figure supplement 1). We also evaluated the expression of both Jag1 and Jag2 ligands in this region of the heart. Jag1 protein was specifically detected within the distal outflow wall and in the core of the ICVS at both E10.5 and E11.5 (Figure 5C,G,K). In contrast, Jag2 was detected only in the inner adluminal region of the ICVS, close to the Notch1ICD-expressing endothelial cells (Figure 5D,H,L). On closer examination Notch 2, Jag1 and Jag2 were found at the membrane of ICVS cells that expressed Isl1 at E10.5 and E11.5 whereas N1ICD was mostly expressed in the nucleus of Isl1-negative cells (Figure 5Q-AB and Figure 5—figure supplement 2). By E12.5, neither N1ICD or Notch2, nor Jag1 or Jag2, were expressed in the interstitial cells within the ICVS (Figure 5M–P), although both N1ICD and Notch2 were expressed in the valve endothelium. Thus, it appeared that Notch signalling was temporally and spatially associated with differentiation of ICVS SHF-derived cells into valve interstitial cells.

10.7554/eLife.34110.013Figure 5.

Notch signalling is found in the developing ICVS.

All sections are frontal unless otherwise stated. Images are typical examples from a minimum of n = 3 at each stage. In E-AB, arrows point to the ICVS. (A–D) Sagittal sections show that Notch1ICD, Notch2 and Jag1 are abundant in the distal outflow wall (arrows) at E10.5. Jag2 is only found in the endothelium (arrow in D). (E–L) Notch1ICD, Notch2, Jag1 and Jag2 are found in the endocardium overlying the main cushions, but not within the cushions themselves at E10.5–11.5. All four localise to the ICVS at E10.5, with Notch1ICD, Notch2 and Jag1 maintained at E11.5. (M–P) Notch1ICD, Notch2 and Jag1 are found in the valve endothelium at E12.5, but none of these, nor Jag2, is found in the valve interstitial cells G-AB) Isl1 and Notch1ICD co-localise in the nuclei of only a few cells within the ICVS at E10.5, although Notch2, Jag1 and Jag2 are found in the membrane of Isl1 +nuclei containing cells in the core of the ICVS at this stage. Scale bar: A-D = 360 μm, E-H = 120 μm, I-L = 150 μm, M-P = 225 μm, Q-AB = 75 μm.

10.7554/eLife.34110.014Figure 5—figure supplement 1.

Dll4 immuno-reactivity is found in the endocardium from E10.5-E12.5 (arrows).

There is no positive staining in the developing ICVS (arrowheads). N.B. Due to the high levels of autofluorescence seen in the myocardium, there was background staining in this tissue at all stages that was not possible to remove. However, at all stages, staining in the ICVS was the same or less than that seen in the myocardium.

10.7554/eLife.34110.015Figure 5—figure supplement 2.

Notch1ICD (A–C) is expressed in the nucleus of cells in the ICVS, but is not generally co-expressed with Isl1 at E11.5.

Notch2 (D–F), and Jag2 (J–L) are found at the cell membrane in the ICVS but only at low level. In contrast, Jag1, although also in the cell membrane, is found in the cells that also express Isl1 at E11.5.

To test the requirement for Jag-Notch signalling in formation of the ICVS, we deleted Jag1 gene expression using Tnnt2-Cre and examined the arterial valve appearances at E16.5. No Jag1^f/f;Tnnt2-Cre (0/11) or Jag2^f/f;Tnnt2-Cre (0/2) embryos demonstrated BAV, nor were abnormalities observed in Tnnt2-Cre-negative embryos (Figure 6A). We therefore wondered if Jag1 and Jag2 might be compensating for each other in the formation of the ICVS, as has been demonstrated in ventricular maturation (D'Amato et al., 2016). Jag1^f/f, Jag2^f/f and Tnnt2-Cre animals were inter-crossed and the arterial valve phenotype examined in the resulting offspring. In this complex genetic breeding experiment, BAV was observed in 1/3 Jag1^f/+;Jag2^f/f;Tnnt2-Cre mutants examined (Figure 6B), whilst in the absence of both ligands 4/11 Jag1^f/f;Jag2^f/fcTnnt2-Cre embryos demonstrated BAV (Figure 6C). Notably, the posterior (non-coronary) leaflet appeared to be missing in each case and there was no obvious presence of a raphe that would indicate leaflet fusion. One additional Jag1^f/f;Jag2^f/f;Tnnt2-Cre embryo had only a rudimentary posterior leaflet (Figure 6D) and a further 4/11 Jag1^f/f;Jag2^f/f;Tnnt2-Cre embryos had thickened or dysplastic arterial valve leaflets affecting either/both the aorta and pulmonary valve (Figure 6C). In these latter cases, abnormalities in all three leaflets of the valves were apparent. Thus, 9/11 Jag1^f/f;Jag2^f/f;Tnnt2-Cre embryos examined had major abnormalities in the development of the arterial valve leaflets, that affected the anterior/posterior leaflets that develop from the Tnnt2-Cre+ ICVS. Most (7/9) of these valve defects in the Jag1^f/f;Jag2^f/f;Tnnt2-Cre embryos occurred in the context of other cardiac anomalies, most commonly ventricular septal defect or double outlet right ventricle.

10.7554/eLife.34110.016Figure 6.

Disruption of Notch signalling results in abnormalities of the posterior (non-coronary) leaflet.

Transverse H and E-stained sections of E16.5 embryos from Jag1^f;Jag2^f;Tnnt2-Cre litters. Images are typical examples. (A–D) Whereas the control embryo has three thinned leaflets in its aortic valve (A), the Jag1^f/+;Jag2^f/f;Tnnt2-Cre and Jag1^f/f;Jag2^f/f;Tnnt2-Cre embryo (B,C) have only two thickened leaflets with no leaflet in the posterior position (*). In the Jag1^f/f;Jag2^f/f;Tnnt2-Cre embryo (D) a rudimentary posterior leaflet can be seen. The arrows point to the thickened left leaflet. (E,F) The Mib1^f/f;Tnnt2-Cre embryo also has a hypoplastic posterior leaflet and dysplasia of the other valve leaflets. (G,H) Examination of the forming ICVS at E11.5 shows a reduction in the number of Sox9+/Isl1 +cells in the Mib1^f/f;Tnnt2-Cre embryo compared to its control littermate. Images are typical examples from a minimum of n = 3 at each stage. A - anterior, L – left, R – right. Scale bar: A-F = 200 μm, G,H = 60 μm.

Similar abnormalities to those we observed in Jag2^f/f;Tnnt2-Cre mutants have previously been described for the Notch regulator Mib1^f/f;Tnnt2-Cre embryos (Captur et al., 2016). We therefore confirmed these findings, showing absence (1/9) or dysplasia (8/9) of the non-adjacent (non-coronary) leaflet in the mutant embryos at E16.5 (Figure 6E,F). We then examined the formation of the ICVS in these mutants at E11.5, showing that in 1/3 of the Mib1^f/f;Tnnt2-Cre examined, the ICVS were poorly formed with fewer Sox9+/Isl1 +cells (Figure 6G,H). This supports the idea that Notch signalling plays a critical role in the formation of the ICVS.

SHF deficiency leads to ICVS defects and BAV

These data indicate that the SHF addition to the outflow tract wall is required for formation of the ICVS, which then give rise to the posterior leaflet of the aortic valve and the anterior leaflet of the pulmonary valve. We wondered if reduction of SHF addition to the ICVS would be sufficient to create hypoplastic ICVS and produce BAV. We have previously disrupted SHF addition to the outflow tract by deleting Vangl2 gene expression from the SHF using Isl1-Cre. This resulted in disruption of epithelial polarity and premature differentiation of SHF cells within the distal outflow tract of Vangl2;Isl1-Cre mutants, leading to double outlet right ventricle and ventricular septal defect (Ramsbottom et al., 2014). At that time, we did not examine the development of the aortic and pulmonary valves. As the naturally occurring Vangl2 mutant loop-tail, which is fully re-capitulated by SHF deletion of Vangl2 (Ramsbottom et al., 2014), demonstrates aortic, but not pulmonary, hypoplasia (Henderson et al., 2001), we speculated that loss of Vangl2 in the SHF progenitors would disrupt formation of the ICVS, particularly affecting the aortic side of the outflow. Analysis of seven Vangl2^f/f;Isl1-Cre embryos at E15.5 revealed that 57% (4/7) of them had dysplastic leaflets and BAV without raphe, with absence of the leaflet normally positioned posteriorly (Figure 7A–D and Figure 7—figure supplement 1). Dysplasia of the pulmonary valve was also observed in these hearts. Analysis at E10.5 and 11.5 showed that although both the aortic and the pulmonary ICVS were present in Vangl2^f/f;Isl1-Cre heart, they were misplaced. In 2/6 cases, they were also smaller than expected (Figure 7E–H). Despite this they demonstrated apparently normal expression of a panel of markers at E11.5, including Isl1, β-catenin and E-cadherin (Figure 7E–H and Figure 7—figure supplements 1 and 2). However, Notch1ICD and Jag1 were missing or reduced in 2/3 E11.5 Vangl2^f/f;Isl1-Cre hearts examined (Figure 7I–L), suggesting that Notch signalling was disrupted in these mutants. Moreover, there was abnormal distribution of cTnI-expressing myocardial cells surrounding the ICVS at E11.5 and E12.5 (arrows in Figure 7—figure supplements 1 and 2). Close examination suggested that these were within the ICVS/valve primordium and so likely reflect abnormal differentiation or ingrowth of cardiomyocytes rather than detachment of layers of myocardium. Together, the hypoplastic ICVS and misexpression of cTnI suggest that rather than forming valve interstitial cells, the ICVS may be mis-specified or prematurely differentiate to myocardium, thus preventing the formation of a mature leaflet in this position.

10.7554/eLife.34110.017Figure 7.

Failure to form the aortic posterior (non-coronary) leaflet in Vangl2^f/f;Isl1Cre embryos.

Images are typical examples of a minimum of n = 3. (A–D) Whereas the posterior leaflet (arrow in A) can clearly be seen in the control embryo at E15.5, this is missing in the Vangl2^f/f;Isl1-Cre embryos (arrowhead in C). (E–H) Hypoplastic and malpositioned ICVS (arrows) can be seen in Vangl2^f/f;Isl1-Cre embryos at E11.5. Expression of outflow markers appears otherwise normal. (I–L) Notch1ICD and Jag1 expression levels are reduced in the ICVS of some Vangl2^f/f;Isl1-Cre embryos compared to control littermates at E11.5 (arrows), although there is normal expression elsewhere in the outflow walls. Scale bar: A-D = 120 μm, E-H = 100 μm, I-L = 120 μm.

10.7554/eLife.34110.018Figure 7—figure supplement 1.

ICVS formation in Vangl2;Isl1-Cre mutants.

(A–D) Three sinuses can be seen in control aortic roots at E15.5, reflecting three valve leaflets. In contrast, only two sinuses and leaflets are seen in the Vangl2^f/f;Isl1-Cre. (D–I) although there are some differences in overall morphology, Versican, N1ICD and E-cadherin are all expressed normally in the Vangl2^f/f;Isl1-Cre ICVS (arrows) at E11.5, when compared with control littermates. However, cTnI is found in the mutant ICVS in F (arrow).

10.7554/eLife.34110.019Figure 7—figure supplement 2.

Marker expression in Vangl2;Isl1-Cre mutant ICVS.

(A-F) Isl1, Sox9 and β-cat are all expressed apparently normally in ICVS (arrows) of Vangl2^f/f;Isl1-Cre embryos at E11.5, although they are misplaced. (G–J) The ICVS is distinct from the cTnI-labelled myocardium in control embryos at E11.5 and E12.5, whereas cardiomyocytes are found within the ICVS (arrows) in the Vangl2^f/f;Isl1-Cre embryos.

DiGeorge syndrome is a chromosomal micro-deletion syndrome with cardiovascular defects, due to deficiency of the TBX1 gene. Tbx1 null mice replicate the cardiovascular features seen in patients with DiGeorge syndrome. As the SHF-derived pulmonary myocardium of the outflow tract is deficient in these mice, and absence of the anterior leaflet of the pulmonary valve has also been reported (Théveniau-Ruissy et al., 2008), we wondered whether these mutants might exhibit hypoplasia of the pulmonary ICVS. Analysis of Tbx1 null mice at E15.5 and E12.5 confirmed that the valve leaflets were markedly abnormal within the unseptated Tbx1^-/- outflow tract (Figure 8A,D). Utilising αSMA and cTnI antibodies, a single ICVS could be seen in the Tbx1^-/- outflow tract at E12.5. Looking earlier, at E11.5, whereas a well-developed aortic ICVS could be seen in Tbx1^-/-, it was impossible to distinguish a discrete pulmonary ICVS, with cTnI and αSMA-expressing cells within the expected region (Figure 8E–H). Thus, as in Vangl2;Isl1-Cre mutants, the disrupted development of the ICVS may underpin, at least in part, the arterial valve defects seen in Tbx1 mutant mice.

10.7554/eLife.34110.020Figure 8.

Failure to form the pulmonary anterior leaflet in Tbx1 null embryos.

Images are typical examples of a minimum of n = 3. (A,B) The outflow tract remains unseptated and the valve leaflets are markedly abnormal in the Tbx1^-/- at E15.5. It is not possible at this stage to establish the identity of the leaflets. (C–F) At E12.5, Tbx1^+/- embryos have septated their outflow tract and have three leaflet primordia in both the aorta and pulmonary trunk. In contrast, the Tbx1^-/- littermate has not septated its outflow tract and there is a single ICVS (arrows in D and F). (G,H) At E11.5, the aortic and pulmonary ICVS are obvious and are distinct from the myocardial wall (labelled yellow by αSMA/cTnI dual staining) in the Tbx1^+/- embryo. In contrast, only a single ICVS (arrow) is seen in the Tbx1^-/- embryo. Scale bar: A = 150 μm, B-F = 100 μm.

Mouse strains and histological analysis

CD1 mice were used to observe normal histology of the developing heart. Mef2c-AHF-Cre (Verzi et al., 2005), Wnt1-Cre (Danielian et al., 1998), Tek-Cre (Kisanuki et al., 2001), Wt1-ERT-Cre (Zhou et al., 2008) and Tnnt2-Cre (Jiao et al., 2003), intercrossed with the ROSA-Stop-eYFP (Srinivas et al., 2001) or mTmG (Muzumdar et al., 2007), were used to follow cells of the required lineage/cell type. As both marker genes are targeted into the Rosa26 locus and there is no suggestion of differences in recombination in response to Cre between these two lines (Liu et al., 2013), the two lines were used interchangeably. Vangl2^flox;Isl1-Cre (Ramsbottom et al., 2014), Tbx1 (Jerome and Papaioannou, 2001), Jag1^flox;Jag2^flox;Tnnt2-Cre (D'Amato et al., 2016), and Mib1^flox;Tnnt2-Cre (Garg et al., 2005) were used and genotyped as described previously. Timed matings were carried out overnight and the presence of a copulation plug was designated embryonic day (E) 0.5. All mice were maintained on a C57Bl/6 background, backcrossed for three generations, then maintained by brother-sister matings. Littermate controls were used where appropriate. Each experiment was carried out in, at minimal, triplicate. Cre expression was induced in the Wt1-ERT-Cre line by Tamoxifen injection. Pregnant females were injected intraperitoneally with 100 µl of tamoxifen (10 mg/ml) dissolved in ethanol and peanut oil on three consecutive days (E9.5, E10.5, E11.5). Embryos were then collected at E12.5. Mice were maintained according to the Animals (Scientific Procedures) Act 1986, United Kingdom, under project license PPL 30/3876. All experiments were approved by the Newcastle University Ethical Review Panel.

Embryos were harvested at different developmental stages, rinsed in ice-cold phosphate-buffered saline (PBS) and fixed in 4% paraformaldehyde at 4°C, the duration of which depended on the age of the embryo (4 hr for E9.5–10.5, overnight for E11.5 and 48 hr for E12.5 to E15.5), before paraffin embedding. Embryos were embedded in either a transverse, frontal or sagittal orientation. For each analysis carried out using embryos, a minimum of 3 embryos for each developmental stage and section orientation were used (biological replicates). Stage matching was carried out based on somite counting and other external features such as limb maturity. The analyses were carried out as separate experiments and a minimum of 5–10 sections (technical replicates) were analysed for consistency. For basic histological analysis, paraffin-embedded embryos were sectioned and stained with haemotoxylin and eosin following standard protocols.

Human embryos

The human embryonic and fetal material was provided by the Joint MRC/Wellcome Trust (grant # 099175/Z/12/Z) Human Developmental Biology Resource (www.hdbr.org [Gerrelli et al., 2015]). For basic histological analysis, paraffin-embedded embryos were sectioned and stained with haemotoxylin and eosin following standard protocols.

Three-dimensional reconstruction

Serial sections were photographed from control and mutant embryos at E10.5 and E11.5. The sections were aligned and three dimensional reconstructions were carried out using Amira 4.0 according to standard protocols (Soufan et al., 2003).

Immunohistochemistry/Immunofluorescence

Methodology has been published previously (Phillips et al., 2007). Sections were cut from paraffin embedded embryos at 8 µm using a rotary microtome (Leica). Slides were de-waxed with Histoclear (National Diagnostics) and rehydrated through a series of ethanol washes. For immunohistochemistry for lineage tracing purposes, endogenous peroxidases were inhibited by treating slides with 3% H₂O₂ for 5 min. Following washes in PBS, antigen retrieval was performed by boiling slides in citrate buffer (0.01 mol/L) pH 6.3 for 5 min. Samples were blocked in 10% FCS and then incubated overnight at 4°C with the primary antibody GFP (Abcam) diluted in 2% FCS. Samples were then incubated with an anti-chicken biotinylated secondary antibody (Dako) for 1 hr, then with AB complex (Vector labs) for 30 min then stained with DAB and mounted using Histomount. This amplification step ensured maximal detection of antigen. Bright field images were captured using the Zeiss Axioplan. For immunofluorescence, following washes in PBS, antigen retrieval was performed by boiling slides in citrate buffer (0.01 mol/L) pH 6.3 for 5 min. Sections were blocked in 10% FCS and then incubated overnight at 4°C with the primary antibodies (see key resources table) diluted in 2% FCS. After washing, sections were incubated at room temperature for one hour, with secondary antibodies conjugated to either Alexa 488 or Alexa 594 (Life Technologies). Fluorescent slides were then mounted with Vectashield Mounting medium with DAPI (Vector Labs). Each experiment was carried out in triplicate using separate embryos (>3) and imaging multiple sections of the structure of interest (>5). Immunofluorescence images were collected with using a Zeiss Axioimager Z1 fluorescence microscope equipped with Zeiss Apotome 2 (Zeiss, Germany). Acquired images were processed with AxioVision Rel 4.9 software.

cDNA probes and in situ hybridisation

Methodology was adapted from (Smart et al., 2002). Digoxigenin (DIG)-labeled RNA antisense probes corresponding to the protein coding regions of Slug (EF450456.1; Forward primer: TTTCAACGCCTCCAAGAAGC; Reverse primer: TAATACGACTCACTATAGGGGCAGCCAGACTCCTCATGTT) and Snail (NM_001032543; [Sefton et al., 1998]) were synthesized by T7 RNA polymerase (MAXIScript, Ambion) and in vitro transcription (pGEM_T easy, Promega), respectively. The slide in situ hybridization was performed using 10 um paraffin-embedded sections of E10.5 and E11.5 mouse embryos. Slides were de-waxed with Histoclear (National Diagnostics) and rehydrated with ethanol series washes. Slides were then fixed in 4% DEPC-PFA for 20 min at room temperature prior to the treatment with proteinase K (10 µg/mL) for 10 min at 37°C. Post-fixation by 4% DEPC-PFA was performed at room temperature for 5 min. Slides were then processed to the acetylation reaction for 10 min in solution containing 100 mM Triethanolamine, 40 mM Hydrochloric acid and 250 mM Acetic Anhydride. After that, pre-hybridization was performed for 2 hr at 68°C using hybridization buffer (50% formamide, 5x SSC (pH6), 200 µg/mL T-RNA, 100 µg/mL Heparin, 0.1% tween-20); hybridization was carried out for 16 hr using the same buffer with RNA probes. Following a series of washes, slides were blocked in 2% MABT (maleic acid buffer containing Tween 20) blocking solution (Roche) for 2 hr and incubated with anti-digoxigenin-AP, fab fragments (Roche) overnight at 4°C. Slides were then developed in NBT/BCIP solution for 18–36 hr at room temperature and the reaction terminated through incubation in 100% methanol for 5 min. Counterstaining with 1% eosin for 5 min was performed, followed by dehydration with washes in a serial ethanol dilutions (30–60 s per wash), incubation in Histoclear twice for 10 min, and finally mounting slides with Histomount (Agar scientific). Each experiment was carried out in triplicate using separate embryos (>3) and imaging multiple sections of the structure of interest (>5).

Cell counts and statistical analysis

For quantification of Mef2c-AHF-Cre in the E12.5 arterial valve leaflet primordia, labelled and unlabelled cells were counted by a single observer (with checks for accuracy from an independent observer) from each of the six discrete primordia. In each case, three representative sections from three different embryos were counted. All sections were 8 µm (as were comparable data sets in Phillips et al., 2013). Chi squared analysis was used to show that the proportion of Mef2c-AHF-Cre lineage cells between the different arterial valve primordia were significantly different. Pairwise chi-squared comparison between the primordia, with Bonferroni correction for multiple testing, confirmed that the aortic non-coronary primordium was statistically different from all other primordia.